1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
10

A cell from a tissue culture has 38 chromoses after mitosis and cytokinesis one daughter cell has 37 what might occurred to caus

e the abnormal chromosome number​
Biology
1 answer:
ankoles [38]3 years ago
7 0

Answer:

occurred an aneuploidy (monosomy)

Explanation:

Aneuploidy can be defined as a chromosomal aberration in which the chromosome number is abnormal. In an aneuploidy, the number of total chromosomes in daughter cells is not an exact multiple of a haploid set, by either gaining or losing chromosomes during mitosis. Aneuploidies are common in cancer cells and in different types of chromosome disorders. Moreover, monosomy is a type of aneuploidy in which daughter cells have a single chromosome copy instead of the two copies found in diploid cells. For example, Turner syndrome is a monosomy caused by the loss of the X chromosome.

You might be interested in
A divide as it relates to earth science is the
gulaghasi [49]
A divide is the elevated boundary between areas that are drained by different rivers system
3 0
3 years ago
Read 2 more answers
Examine the cell diagrams shown. Which of the following choices identifies the eukaryotic cell for the correct reason?
Simora [160]

Answer:

Option a

Explanation:

A eukaroytic cell contains more organelles than prokaryotic cells, and it is much bigger and complex.

hope this helps and is right :)

6 0
2 years ago
Which of the following is not a human induced cause of extinction
vagabundo [1.1K]

D.) none of the above is human induced cause of extinction

8 0
3 years ago
Read 2 more answers
Ow might cancer stem cells can lead to the reoccurrence of turmors
Butoxors [25]

Answer:

BBC

Explanation:

Big black chicken

5 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Autonomic centers in the ________ exert neural control over hormone secretion by the adrenal medullae. a) pineal gland b) pituit
    6·1 answer
  • Which of the following are examples of trisomy?
    8·1 answer
  • The cytoplasm surrounds the nucleus of the cell and contains organelles. Select the organelles found in the cytoplasm. Select al
    5·1 answer
  • Plz need to answer a b c d
    12·2 answers
  • When the membranes that cover the brain herniate through the opening of the skull, the condition is called:?
    11·1 answer
  • A researcher is creating pedigrees for a trait he suspects to be dominant in humans. what are some of the likely features of his
    13·2 answers
  • Study this image which statement best describes the rock shown check all that apply
    13·2 answers
  • What would happen if your heart valves stopped working?
    5·1 answer
  • Deserts can be found near oceans on the coast of continents? true or false
    5·2 answers
  • What are the two reactions that take place in the process of photosynthesis?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!