1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ugo [173]
3 years ago
13

Harold filled his swimming pool over the weekend. The pool has a capacity of 540 gallons. Harold put in 180 gallons of water on

Saturday. The garden hose that Harold used supplies 9 gallons of water per minute. How long did it take for Harold to fill the pool to capacity on​ Sunday? Define a variable for the unknown quantity. Write and solve an equation to answer the question.
Let m= the number of _________
a.) gallons in the pool on Sunday
b.) Minutes to fill the pool on Saturday
c.) gallons the garden hose puts in the pool on Sunday
d.) minutes to fill the pool on Sunday

An equation to represent the situation is __________=540.
a.) m+89
b.) 189m
c.) 9m+180
d.) 180m+9

So, m= _________. It took Harold ____________ minutes to fill the pool to capacity on Sunday.
Mathematics
1 answer:
aleksandrvk [35]3 years ago
6 0

Answer:

b

c

40

Step-by-step explanation:

I have already had this question before.

You might be interested in
Which number property is illustrated in the Identy ?
zhuklara [117]
The property of this equation is associative property
4 0
1 year ago
You can buy 20 fluid ounces of shampoo for $4.40 or, you can buy 24 fluid ounces for $4.80 which is the better buy? Please answe
erica [24]

Answer: the 20 fluid ounces is better

Step-by-step explanation:

If you divide 20 by 4.40 that is 4.54 but if you divide 24 by 4.80 that is 5. You want to divide 20 by 4.40 because 20 is the fluid ounces and 4.40 is the money divide that to get the cost per fluid ounce then you do the same with the 24 fluid ounces and by doing that you get the sot for 1 fluid ounce then look at both of your answers and see which one is less. which one is less is the better one.

8 0
2 years ago
Bill and susan have ages that are consecutive odd integers.The product of their ages 438.Which equation could be used to find bi
zhuklara [117]

Answer:

4 x^{2} + 8 x - 435=0

Step-by-step explanation:

Let x be any natural number

Let the age of Bill= 2 x+ 1  years (Since age is odd integer)

Than, age of a Susan= 2 x + 3 years

Since ages are consecutive odd integers

According to question

(2 x+1)(2 x+ 3)= 438

4 x^{2} + 8 x + 3 = 438

4 x^{2} + 8 x + 3 - 438 =0

4 x^{2} + 8 x - 435=0

This equation can be used to find the ages of both

Hence, the correct answer is 4 x^{2} + 8 x - 435=0

5 0
3 years ago
How to simplify 2a(x)=4a^3-6a
wlad13 [49]
The answer is   x = 2a^3 - 3a
6 0
3 years ago
Can someone please help me with this question ASAP
Lana71 [14]

Answer:

  • x - 7.31 ≤ 10
  • x ≤ 17.31

Step-by-step explanation:

let x = the amount of money in the second piggy back

We assume that the second piggy bank has MORE than the piggy bank with $7.31 in it:

x - 7.31 ≤ 10

<u>Solution</u>

Add 7.31 to both sides:  x - 7.31 + 7.31 ≤ 10 + 7.31

                                                       ⇒ x ≤ 17.31

8 0
2 years ago
Other questions:
  • Y- 7 = -4<br>How do I solve this question​
    5·2 answers
  • Gcf of 56, 42 and 98
    11·1 answer
  • 21,4,9,19,25,16,27,30,33,15,31 Minimum: Quartile1: Quartile2: Quartile3: Maximum:
    14·1 answer
  • Evaluate 4 2/3-(-1 4/5)
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Which is a solution to the equation?<br> (x-2)(x + 5) = 18
    9·2 answers
  • 2. Which equation represents a line that is perpendicular to the line<br> represented by y = 2/3 + 1
    8·1 answer
  • One number is nine more than another number.if the sum of the number is 65 ,find both numbers
    15·1 answer
  • What is 68.500.000 written in scientific notation?
    7·1 answer
  • A 9-foot piece of twine cost 28.08.What is the price per inch
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!