Answer:
The answer is option c.
Genetic material composed of DNA
Hope this helps.
2 amino acids; codon = a triplet & 1 codon codes for 1 amino acid therefore if are 2 mRNA codons then you’ll have 2 amino acids
Answer: p (short hair) = 0.91 and q (long hair) = 0.09
Explanation: In the population, short hair is a feature of domnant allele, because there are more short haired individuals than with long hair. In genetics, p is the frequency for dominant allele and q is for recessive allele.
For this question, short hair is allele L and long hair is allele l
So, the frequency of short hair is p and of long hair is q.
To calculate the frequencies:
Frequency of allele L = (number of copies of allele L in population) / (total number of L/l gene copies in population)
p = 182/200 = 0.91
The same formula goes for the recessive allele, so:
q = 18/200 = 0.09
Thus, the frequencies of hair allele are 0.91 and 0.09 for short and long, respectively.
Answer:
They formed from a cloud of dust and gas.
Explanation:
A nebula is where the formation of stars takes place, so the Nebula Theory would pertain to the planets forming in the same way.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
