1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
2 years ago
13

A __ is a moderately wet and mild biome with four distinct seasons. Many trees are present with most annually losing their leave

s in autumn. Animals are generally permanent residents.
Biology
1 answer:
Softa [21]2 years ago
8 0

Answer:

Temperate Deciduous Forest

Explanation:

You might be interested in
The mass of an atom is contained primarily in its _____. electron shell nucleus protons size
Anuta_ua [19.1K]
Nucleus is the correct answer
7 0
3 years ago
Read 2 more answers
Choose all the right answers.
jeka57 [31]
A plant begin to produce its own food in the following cases:
-when the first leaves are formed
-as soon as photosynthesis starts

Even the little new seeds grown-up from the food reserves, but start making their owm food as they see sunlight
4 0
3 years ago
Particles that "orbit" the center of an atom are called *
Leona [35]

Answer:

protons and neutrons

Explanation:

loki

5 0
3 years ago
Please help me for 10 points
ahrayia [7]
The answer is immune system
6 0
2 years ago
Populations with _______ are more likely to survive in different environments.
Klio2033 [76]
I believe it's B. That would be the best guess
8 0
3 years ago
Other questions:
  • During which phase of mitosis does cytokinesis take place
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How does incomplete dominance differ from a dominant recessive pair of alleles?
    8·1 answer
  • Which type of growth can occur only when a population has unlimited resources?
    10·2 answers
  • A combined sewer system carried___ to a sewage treatment plant. A. Household waste water B. Rain water C. Lawn run of D. All the
    5·1 answer
  • Which protist would most likely be phytoplankton?
    14·1 answer
  • If you had to explain homeostasis to a friend who was absent for this topic how would you explain it
    6·2 answers
  • The graph shows the populations of two species in a particular region over two decades. Based on the graph, what can you conclud
    5·1 answer
  • Define cell and atom.....​
    5·1 answer
  • What is the key to most Al challenges?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!