2 years ago

___ is in the intestines, liquid from the kidneys and pancreas mix with leftovers from the stomach. chamical or physical

Biology

1 answer:

Olin [163]2 years ago

3 0

Answer: Chemical

Explanation:

Chemical is in the intestines, they are called Hydrochloric acid (HCl), and acts to break down food substances into absorbable form by cells.

Liquids are retained from the kidneys by the action of Anti-diuretic hormone (ADH) and mixes with the food leftovers to form excreta passed out of the rectum.

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

What is cellular respiration

valina [46]

Cellular respiration is the process by which the body breaks down sugar like glucose, to release ATP, which is an energy storing molecule. This is how the body gets energy from food.

5 0

3 years ago

Read 2 more answers

Basophils of the blood help to get defensive leukocytes to the site quickly by releasing an anticoagulant called __________ and

Sati [7]

Heparin and histamine

6 0

3 years ago

A marine biologist observed an organism. it had openings on its body through which food particles and water passed. which phylum

LenKa [72]

The Organism that the biologist observed was a part of the Porifera phylum.

5 0