1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
15

How does artificial selection change a population over time?

Biology
2 answers:
Virty [35]3 years ago
6 0

Answer: The process of domestication is called artificial selection.

Explanation: artificial selection acts by allowing differential reproductive success to individuals with different genetically determined traits in order to increase the frequency of desirable traits in the population. Therefore becoming a verry strong gene.  

olga2289 [7]3 years ago
5 0

Answer:

Explanation:

Like natural selection, artificial selection acts by allowing differential reproductive success to individuals with different genetically determined traits in order to increase the frequency of desirable traits in the population.

You might be interested in
What are the 6 steps to the scientific method?
valentina_108 [34]
Purpose/question, research, hypothesis, experiment, data/analysis, and the conclusion
6 0
3 years ago
Read 2 more answers
Processes that increase the density of seawater include evaporation and _____.
Nadya [2.5K]

Question: Processes that increase the density of seawater include evaporation and

Answer: formation of sea ice

Explanation: Sea ice formation lowers the seawaters temperature while evaporation increases the salinity.

question answered by

(jacemorris04)

7 0
4 years ago
Read 2 more answers
Why is the sky blue
horsena [70]

Answer:

Sunlight reaches Earth's atmosphere and is scattered in all directions by all the gases and particles in the air. Blue light is scattered more than the other colors because it travels as shorter, smaller waves. This is why we see a blue sky most of the time.

6 0
3 years ago
Read 2 more answers
What are the changes around us that show that a chemical reacts and does not react?
Kobotan [32]
A chemical reaction is something that cant be changed for example: burning wood is a chemical reaction because when you burn wood you cant turn it back to regular wood.


Hopes this helps ;) <span />
8 0
4 years ago
Statistical methods are classified into which two major categories
goldenfox [79]
Descriptive and inferential
8 0
3 years ago
Other questions:
  • Some mutations have no observable effect on the phenotype. what is the term for this type of mutation?
    10·1 answer
  • Why are capillaries small and thin
    6·1 answer
  • _____ is a behavior in mating in which one male breeds with a female for a certain period of time and then finds a different mat
    8·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • What is the outermost structure that surounds and supports plant and fungal cells?
    8·1 answer
  • In general, life needs to maintain a pH level between____.<br> 0)1-4<br> 0)5-8<br> 0)9-14
    10·1 answer
  • What is the link between these three images
    14·2 answers
  • Which effect of temperature rise causes a feedback resulting in a rise in global temperatures?
    11·1 answer
  • What gift did dr paricia get her mother
    14·1 answer
  • Excess post-exercise oxygen consumption is the extra amount of oxygen consumed after the completion of exercise and before respi
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!