Answer:
(A) It prevents electron flow from the iron-sulfur centers in complex 1 to the ubiquinone. Due to reduction in electron transfer rate, there is a decrease in the production of ATP which is dangerous for some insects and fish over time.
(B) It also prevents electron flow from cytochrome b to cytochrome c1 at the complex III which leads to QH2 accumulation. If oxidized Q is not present, these is alteration of electron flow and the production of ATP is altered.
(C) Rotenone only prevent electron transfer into the chain at Complex 1 but it does not affect electron transfer at Complex II. Although there is slow ETC, it does not stop completely. However, Antimycin A prevents the oxidation of QH2, the final electron acceptor crom complex I and complex II. Thereby, stopping the production of both ETC and ATP. It can be concluded that antimycin A is a more potent poison.
Explanation:
Rotenone prevents electron flow from the iron-sulfur centers in complex 1 to the ubiquinone. Due to a reduction in electron transfer rate, there is a decrease in the production of ATP which is dangerous for some insects and fish over time. Antimycin A also prevents electron flow from cytochrome b to cytochrome c1 at the complex III which leads to QH2 accumulation. If oxidized Q is not present, there is an alteration of electron flow and the production of ATP is altered. Antimycin A is more potent than rotenone.
Answer:
increasing
Explanation:
the sun is not bad for plants. In fact, it makes them grow. Its like without no food.
Answer:
a. mimicry
Explanation:
Stick bugs are perhaps one of the better known examples of insect mimicry. Their twig-like appearance helps to defend them against predators that hunt by sight.
Answer:
the answer is 5x-5t equals s
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.