1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
3 years ago
12

If two heterozygous mate, what will be the genotypic ratio of their offspring

Biology
1 answer:
Studentka2010 [4]3 years ago
6 0
It would be 3 (HH and Hh) to 1 (hh).
You might be interested in
Rotenone, a toxic compound isolated from plants, strongly inhibits the transfer of electrons from iron-sulfur centers in Complex
Darya [45]

Answer:

(A) It prevents electron flow from the iron-sulfur centers in complex 1 to the ubiquinone. Due to reduction in electron transfer rate, there is a decrease in the production of ATP which is dangerous for some insects and fish over time.

(B) It also prevents electron flow from cytochrome b to cytochrome c1 at the complex III which leads to QH2 accumulation. If oxidized Q is not present, these is alteration of electron flow and the production of ATP is altered.

(C) Rotenone only prevent electron transfer into the chain at Complex 1  but it does not affect electron transfer at Complex II. Although there is slow ETC, it does not stop completely. However, Antimycin A prevents the oxidation of QH2, the final electron acceptor crom complex I and complex II. Thereby, stopping the production of both ETC and ATP. It can be concluded that antimycin A is a more potent poison.

Explanation:

Rotenone prevents electron flow from the iron-sulfur centers in complex 1 to the ubiquinone. Due to a reduction in electron transfer rate, there is a decrease in the production of ATP which is dangerous for some insects and fish over time. Antimycin A also prevents electron flow from cytochrome b to cytochrome c1 at the complex III which leads to QH2 accumulation. If oxidized Q is not present, there is an alteration of electron flow and the production of ATP is altered. Antimycin A is more potent than rotenone.

7 0
3 years ago
Read 2 more answers
PLEASE HELP DUE BY 8:30 tomorrow
Y_Kistochka [10]

Answer:

increasing

Explanation:

the sun is not bad for plants. In fact, it makes them grow. Its like without no food.

7 0
3 years ago
The stick bug shown in the picture below evades predators by blending in with its surroundings. What type of
Novay_Z [31]

Answer:

a. mimicry

Explanation:

Stick bugs are perhaps one of the better known examples of insect mimicry. Their twig-like appearance helps to defend them against predators that hunt by sight.

7 0
2 years ago
10. Which term describes the living and nonliving things in an area?
Reil [10]

Answer:

the answer is 5x-5t equals s  

Explanation:    

7 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • Mr. Cortez had a good conversation about the fairness of restitution and retribution with 9-year-old Sherrod. The next day, Sher
    8·1 answer
  • Is it normal for humans to look at bright colors first
    9·1 answer
  • What usually attaches the kidneys to the retroperitoneum?
    10·1 answer
  • (a) List the chemical characteristics of molecules that are most likely to move by simple diffusion across the lipid bilayer of
    12·2 answers
  • What happens during the telephase
    11·1 answer
  • Which of these described climate rather than weather?
    11·2 answers
  • How does the motion of particles in a gas change as the gas cools?
    13·2 answers
  • Which process is the main source of movement
    10·2 answers
  • No Light<br> Yo =<br> Gas<br> Gas<br> Water<br> Plant
    9·1 answer
  • Mention four benefits of rearing the farm animal mentioned in a(i)..-
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!