1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
10

Describe the structure of earth paragraph form

Biology
1 answer:
Alexxx [7]3 years ago
6 0

Answer:

​​The earth is made up of three different layers: the crust, the mantle and the core. This is the outside layer of the earth and is made of solid rock, mostly basalt and granite. Continental crust is less dense, thicker, and mainly composed of granite.

Explanation:

You might be interested in
Which of these is an example of soil contamination?
andreyandreev [35.5K]
Industrial waste! This is because the waste is in direct contact with the soil in the form of chemicals or even heat!
7 0
3 years ago
Read 2 more answers
NEED ASAP BUT TAKE WEB CAPTURE (or screenshot) (web capture: ctrl+shift+s) THEN DRAW ON PICTURE BECAUSE I DONT WANT WORDS
Elden [556K]

I would help but this is the type of project to do on your own. I'd suggest planning out the image then building from there, or use graphs on the internet for inspiration. I wish you luck though :>

7 0
3 years ago
In wich layer of the earth do the deepest of earthquakes occur
Ann [662]
Earthquakes occur all the time all over the world, both along plate edges and along faults. Most earthquakes occur along the edge of the oceanic and continental plates. The earth's crust (the outer layer of the planet) is made up of several pieces, called plates.
3 0
3 years ago
Which body system is responsible for
Leto [7]

Answer: B

Explanation: The circulatory system is responsible for bringing food and oxygen to every cell in your body. The respiratory system is responsible for carrying oxygen and carbon dioxide in and out of your body. The excretory system is responsible for removing waste from your body.

Hoped this helped!!!!!!

8 0
4 years ago
Read 2 more answers
What is involved in redox reactions?
GalinKa [24]
An oxidation-reduction<span> (</span>redox<span>) </span>reaction<span> is a type of chemical </span>reaction<span> that involves a transfer of electrons between two species. An </span>oxidation-reduction reaction<span> is any chemical </span>reaction<span> in which the </span>oxidation<span> number of a molecule, atom, or ion changes by gaining or losing an electron.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • What would happen to the mountain lion population if the deer became extinct?
    13·2 answers
  • Why is there so much variety of bacteria in the mouth
    11·2 answers
  • Are all eukaryotic genes colinear? Yes, because the order of the codons and amino acids is the same in eukaryotes. No, because t
    10·1 answer
  • Did ashley williams have thyroid surgery?
    14·1 answer
  • Why was the stethoscope invented?
    15·1 answer
  • Which of the following is not a characteristic of cancer cells?
    6·1 answer
  • This virus attacks the white blood cells of the human body. Eventually, the immune system cannot handle the viral invasion. This
    13·2 answers
  • How do earth worms breath?
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How are humans a driving selection of tuskless elephants?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!