1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
5

Why the answer is B?​

Biology
2 answers:
sergeinik [125]3 years ago
8 0

Answer:

because your teacher said it is

White raven [17]3 years ago
8 0
Answer:

Because girls have more stronger allele which helps with vision

Hope this helps:)
You might be interested in
Which describes
iragen [17]

Answer:

B. Es la respuesta correcta.

Explanation:

pues heredar es cuando una persona le da unas caracteristricas de ella a otra y q se transmite generacion x generacion.

5 0
1 year ago
How will this change in the environment most likely affect the mouse population?
Rashid [163]

Answer: i think it’s D

Explanation:

4 0
3 years ago
What is the answer for this question please help
Nezavi [6.7K]
The plant belongs to the group Angiosperm. Vascular plants with seeds could be cycads, Gingko, conifers, or angiosperms. Among those groups, only angiosperms have flowers.
The plant they found have colored, scented flowers which suggests that it could be pollinated by insects or birds. Colored flowers attract birds and insects. Color serves as a guiding mark. Talking of scent, it does not attract bird, but attracts insects. It also serves as the guiding mark.
7 0
4 years ago
What is the approximate solution to this equation?
scoray [572]

Answer:

ill come back with a fend that can help and put it in the comets

Explanation:

8 0
3 years ago
Restless tectonic plates move (shift) between one and fifteen centimeters per __________. year month day minute
Wittaler [7]

Hello There!

<u><em>Restless tectonic plates move (shift) between one and fifteen centimeters per "YEAR"</em></u>

<u><em></em></u>

<u><em>Tectonic plates move at a moderate around one and fifteen centimeters  per year. The plates move in different ways, once in a while crashing into one another.</em></u>

6 0
3 years ago
Read 2 more answers
Other questions:
  • Kingdom animalia includes a major phylum known as chordata, which includes the sub-phylum vertebrata. This includes lions like t
    11·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Qué declaracion mejor describe la reproducción entre bacterias en condiciones ideales?
    9·1 answer
  • Sally's teacher asked her to classify the organisms in a sample of pond water. Sally believed that they all belonged to the same
    10·2 answers
  • When an organism of many cells breaks up into two or more parts and these parts survive to produce a new organism, reproduction
    10·2 answers
  • The- - - - - is the area of a tooth the cervix to the apex
    13·1 answer
  • Sound is a form of _______. A. energy B. light C. radiation D. electromagnetism
    6·2 answers
  • What is the correct order in which these structures form during the plant reproduction process?. . a.embryo sac, embryo, zygote.
    6·2 answers
  • Which is it? <br><br>a , b, c, or d?
    10·1 answer
  • What is the most significant difference between freshwater aquatic ecosystems and marine ecosystems?​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!