D. fingernails
Skin, hair, and vertebrae are all the outer layer of the body and protect the body. The fingernails aren't part of that.
Answer:
It is a compound sentence.
Explanation:
Compound sentence contains two independent clauses.
What are the other answers?
I do not think it is A.
Is Simmering an option?
Answer: option D
The sodium potassium ion exchange move sodium and potassium in opposite direction in electrochemical gradients.
Explanation:
The sodium potassium pump is found in many animals plasma membranes and its moves the sodium and potassium ion in opposite direction across the plasma membrane with the hydrolysis of ATP(adenosine triphosphate) to supply the needed energy. It is an active transport process.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser