1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandr82 [10.1K]
3 years ago
10

Please answer

Biology
1 answer:
ki77a [65]3 years ago
5 0
My positive answer is no because of the clothes and yes because of the mask but if it were a yes then astronauts wouldn’t need the space suit so the answer is NO
You might be interested in
A major portion of metabolism occurs in which cell component?
Colt1911 [192]

All of the chemical reactions that take place inside of a cell are collectively called the cell's metabolism.

3 0
3 years ago
PLEASE HELP❤️❤️❤️
Lana71 [14]

Answer:

A. Yes, because molecules move down the

concentration gradient without using energy.

Explanation:

Active transport is the energy-requiring process of pumping molecules and ions across membranes against a concentration gradient. Both endocytosis and exocytosis are active transport processes.

Hope that helps!

6 0
3 years ago
What are three examples of respiration?
brilliants [131]
Some examples are alcohol fermentation, lactic acid fermentation and in decomposition of organic matter.
6 0
3 years ago
What are three anatomical features that birds share with their theropod ancestors
Novosadov [1.4K]
<span>Three anatomical features that birds share with their theropod ancestors are:
</span><span>1. they had light, hollow bones
</span>2. they rearranged hip and leg muscles because this of <span>improved bipedal movement
</span>3. they had their flight oriented with the use of wings for balance
6 0
3 years ago
The energy usage per capita in Africa and Asia have grown tremendously the last 50 years. Which of these would be a good explana
aev [14]

Answer:

B.) These continents have become more industrialized.

Explanation:

These continents have become more industrialized. As they have become more industrialized, the economy grows and so does the need for energy.

6 0
4 years ago
Other questions:
  • Water is warmed by the sun and .
    6·2 answers
  • Most coastal areas on Earth experience two high tides and two low tides every lunar day. What is a lunar day? Our days on Earth
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What would happen if we were to remove a rabbit and a capybara from the food chain?
    11·1 answer
  • Are grapes poisonous for dogs?
    12·2 answers
  • Positive symptoms of schizophrenia, specifically hallucinations and delusions, are thought to be caused by hyperactivity of whic
    5·1 answer
  • A pathologic change in the cardiovascular system that involves degenerative changes in the arteries, promoting the accumulation
    11·1 answer
  • Bacteria in your lab are grown under two conditions, one with exposure to glucose and the other with lactose. what best describe
    11·1 answer
  • I need help with this. I have no clue how to do it and it is due soon. Please help me!!!
    10·1 answer
  • A biologist prepares a culture. After 1 day of growth, the biologist counts 1000 cells. After 2 days of growth, he counts 3000.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!