1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
2 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]2 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
Which of the following is the correct format for an MLA in-text citation for an article with no known author?
fgiga [73]
<span>The correct format for an MLA in-text citation for an article with no known author is A. ("Title" page). The "Title" is the shortened title of the work. It is in lieu of the author's name. The quotation mark that encloses the title is used when the work is a short work like an article. If the work is a long one like books, plays, etc. The title is italicized instead of enclosed in quotation marks.</span>
4 0
3 years ago
The enzyme choline acetyltransferase catalyzes the reaction between acetyl-CoA and choline resulting in the formation of the neu
Nady [450]

Answer: Anterograde direction.

Explanation:

Choline acetyltransferase is an enzyme made in the body of a neuron and that needs to be transferred to the axon terminal to perform its function. Its function is to bind acetyl-CoA to choline to form the neurotransmitter acetylcholine.

The movement toward the cell body is called retrograde transport and the movement toward the synapse is called anterograde transport. So, since it is produced in the body of the cell and it has to go to the axon terminals, the choline acetyltransferase is transported in the anterograde direction.  

This type of transport is responsible for the movement of organelles such as mitochondria, lipids, synaptic vesicles, proteins from a neuron cell body through the cytoplasm of its axon called the axoplasm. <u>Because axons can sometimes be meters long, neurons cannot rely on diffusion to carry products to the end of their axons</u>. Dynein is a motor protein involved in this retrograde axonal transport. Its light chains bind cargo, and its globular head regions bind the microtubule, "moving forward" along it.

5 0
3 years ago
Which of these are considered an oxidizing mutagenic agent?
kherson [118]
Benzopyrene. Is the correct answer
5 0
2 years ago
A cell has 5% salt concentration. It is placed into a solution with a 0.5% salt concentration. What will happen to the cell
yaroslaw [1]

Answer:

The cell will shrink due to osmosis.

Explanation:

As in given question the salt concentration are much more inside the cell, than outside. In order to maintain equilibrium. the water inside the cell will start flowing outside in order to maintain equilibrium, causing shrinkage of cell. The ability of a cell to divide or function will reduce because of water loss. This phenomenon is seen in case of hypertonic solution. Water will start diffusing from the higher concentration to the lower concentration.

6 0
3 years ago
Please help me with this!!!
dsp73

Answer:

I can't see your picture

Explanation:

6 0
3 years ago
Other questions:
  • What is the difference between sun and moon?
    11·2 answers
  • PLEASE HELP
    10·2 answers
  • The key ingredient of an arterial fluid classified as a cosmetic fluid is a(an)?
    9·1 answer
  • Types of Predators
    6·1 answer
  • Your teacher gives you a plant that has vascular tissue, produces seeds, but does not produce flowers. what type of organism is
    5·1 answer
  • Soil is a combination of tiny rock fragments and decayed plant materials. How do you think soil helps a plant
    5·1 answer
  • Witch organism exhibits behavior adaptations
    12·1 answer
  • ¿Cuales son los derechos sexuales y reproductivos?​
    9·1 answer
  • How many chromosomes will be found in each cell during prophase?
    9·1 answer
  • ________ arises when different microbes within a population or community try to acquire the same resource.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!