1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
What element is rarely found in organic molecules? Hydrogen, oxygen, barium or carbon.
Fynjy0 [20]
It is C barium because carbon is in everything and so is oxygen and hydrogen. so has to be C
4 0
4 years ago
Read 2 more answers
What two things does Earth's atmosphere do with solar energy?​
xz_007 [3.2K]

Answer:

The atmosphere and the surface of the Earth together absorb 71 percent of incoming solar radiation, so together, they must radiate that much energy back to space for the planet's average temperature to remain stable.

Explanation:

5 0
3 years ago
Read 2 more answers
Hi please help with these biology questions if you can!
Vilka [71]

Explanation:

1. B"only proteins are formed from amino acids"

2.  D. "They are carbohydrates made of simple sugars"

3. B "monosaccharides"

4. A

6 0
3 years ago
If an object is placed an electric field how will it move
Vaselesa [24]

Answer:

Explanation:

Electric field is a vector quantity whose direction is defined as the direction that a positive test charge would be pushed when placed in the field. Thus, the electric field direction about a positive source charge is always directed away from the positive source.

3 0
2 years ago
How might knowledge of science be important to an artist?
Ne4ueva [31]
Science equals art they are the same thing both science and art are humans attempts to understand and describe the world about usThe subject and message her different directions intended audiences are different but I think the motivations and goals are fundamentally the same
8 0
3 years ago
Other questions:
  • Use the model here to describe the transfer of matter and flow of energy from one trophic level to another within an ecosystem.
    11·2 answers
  • What happens to all the squirrels and lizards during a hurricane?
    7·1 answer
  • 6. Classify Earth's layers based on their physical properties. *
    5·1 answer
  • In a 50 square-mile section of forest, there are some cut patches of forest where the trees have been removed and some patches o
    7·1 answer
  • What are two ways that energy can be conserved?
    11·1 answer
  • #1 Two new methods for cleaning oil spills are being tested and are in phase one of their trials.
    9·1 answer
  • What are the three domains proposed above the kingdom level
    8·1 answer
  • According to the American Council of Exercise, overweight people have, on average, greater than 30% body fat. In graph B, what d
    10·1 answer
  • All organisms must have water for survival. If a drought causes the water in an ecosystem to become scares the organisms in this
    9·1 answer
  • JOINNN MY ZO OMMM me and me firend <br> 95478199526 12345
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!