1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
Hormones work by affecting specific tissues called
balu736 [363]
Target Tissues or organs  <span />
5 0
3 years ago
Matching questions match each description with the appropriate phase of mitosis:
strojnjashka [21]
Hello!!
A: Anaphase — 1 chromatids move towards opposite poles. I always remember that “Ana” moves to different places on the sides of town. This is where the chromatids begin to move.
B: Telophase — 4 Cytokinesis may occur. Cytokinesis is the last and final step. The sister chromatids finish moving towards the poles and then cytokinesis occurs.
C: Metaphase — 3 Chromatids line up in the middle of the cell. I always remember since they line up in the middle, they “met” there.
D: Prophase — 2 and 5 Disintegration of the nuclear membrane and the spindle forms. Both of these have to happen first in order for the rest of the processes to occur.
**The order of mitosis goes prophase, prometaphase, Metaphase, Anaphase, Telophase, and Cytokinesis.**
For the bottom:
A: Algae 6 and 10. Both diatoms and kelps (plant related) are a part of the Algae general type.
B: Fungi 7 and 9. Deuteromycetes and Ascomycetes.
C: Protozoa 8. It is ciliates because they are a major group of Protozoa from cilia.
I hope I helped!! Have a great day!! :)
3 0
3 years ago
Read 2 more answers
Dichotomous keys ask
astraxan [27]
Wut I don’t get it : /
3 0
3 years ago
How is the temperature of a location determined by energy from the sun and the location’s distance from the equator?
sukhopar [10]

Answer:

Energy from the sun is transferred to Earth's surface. Some of that energy is then transferred to the air above the surface. The closer a location is to the equator, the more energy it receives from the sun. Therefore, a location's air temperature is affected by its distance from the equator.

Explanation:

5 0
3 years ago
Help!!! please thank you!​
ipn [44]

Answer:

C. Subduction happens in location A but not in location B

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which method would NOT increase your knowledge of a topic? A) Discussing the topic with expert scientists. B) Surveying opinions
    9·2 answers
  • Slime molds are very interesting organisms. When conditions are good, they live as
    10·1 answer
  • Can anyone please help me with these science questions? 1. What bacteria causes strep throat. 2. name two types of bacteria that
    9·1 answer
  • The force that pulls the moon toward Earth is called
    14·2 answers
  • Genetic counselors are available for diagnosing some diseases, and for helping in family planning. if a genetic counselor examin
    15·1 answer
  • Ok so this is like hard for me I guess but I have a really hard question for the ladies do you ever think it is but it is just ⚪
    15·1 answer
  • Give one example of non-communicable disease
    8·1 answer
  • In your own words, define or describe what you<br> already know about photosynthesis?
    10·2 answers
  • How long does sweetened condensed milk last in the fridge?.
    12·1 answer
  • The construction of wind farms has affected the migratory patterns of some bird populations. Bird populations have be noted to n
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!