1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
Name two types of cells that would be destroyed by apoptosis
schepotkina [342]

Answer:

Apollo and Ikollo

Explanation:

The cell will be exposed to The outer brain making it vulnerable to attack

8 0
4 years ago
Why do we need recycling of carbon?
Step2247 [10]
Helps to reduce pollution in a community
7 0
4 years ago
Mary wants to remove a dent from a ping-pong ball without cutting into the sealed ball. she decides to put the ball in a bowl of
Misha Larkins [42]

The right option is; b. the water caused an increase in temperature of the air inside the ball and an increase in pressure.

The dent (hollow area formed by pressing or hitting) from the ping-pong ball disappeared because energy was transferred from the hot boiling water in which the ball was placed to the air inside the ball. This transferred energy will increase the temperature of the air inside the ball and the air molecules will begin to move faster with a greater force. Hence, causing an increase in pressure.

8 0
3 years ago
Read 2 more answers
A woman is told her weight has a standard score (z-score) of –1.5. this means that
Natasha2012 [34]
This means that her weight is 1.5 standard deviations below the mean. The z-score informs us how many standard deviations above or below the mean a sample (in this case the woman's weight) is. Standard deviation is a statistical measure that expresses how much a sample differs from the mean value of a population or a group of samples. 
8 0
3 years ago
Rna primer constructed during dna replication needs to be replaced because rna differs from dna. What does it contain?
inna [77]
Structurally speaking, RNA and DNA are different. One clear distinction between the two is that RNA is single stranded, while DNA is double stranded. Another way they differ is found in their nitrogen bases. The four bases for DNA are Adenine, Thymine, Cytosine, and Guanine (think, ATCG). The bases for RNA are the same, except Thymine is replaced with Uracil (think, AUCG).

Another note is that RNA polymerase is unable to detect errors in base pairings, unlike DNA polymerase, but their syntheses are both in the 5’3’ direction. Hopefully this helps you answer this question.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Human activities are causing the fragmentation of the brazilian atlantic rain forest. one consequence is that toucans have becom
    12·1 answer
  • You have learned that scientific thinking involves observing, forming hypotheses, testing hypotheses, and analyzing data. use ex
    15·1 answer
  • In fruit flies, the gene for red eyes (R) is dominant and the gene for sepia eyes (r) is recessive. If two red-eyed heterozygous
    11·1 answer
  • How long is a human being one cell for?
    10·1 answer
  • Which process must the cell undergo to have genetically different cells at the end of cell division
    15·2 answers
  • 5. Which of the following about Mendel's Law of Segregation is false?
    6·1 answer
  • Help me out pls thanks !!!!!!
    11·1 answer
  • Bacteria are able to reproduce very quickly through a process known as binary fission. Binary fission requires only one parent.
    6·1 answer
  • Type of biomolecule is used to convert energy to ATP
    14·1 answer
  • Look at the food web below.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!