1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
Genetic information is transmitted from DNA to
Alexus [3.1K]


The best answer is D.

Genetic information for synthesis of a protein is transmitted from DNA to the ribosomes, which are the site for protein synthesis. This is facilitated by messenger RNA or mRNA in short.

In the nucleus of the cell, information from DNA is copied (transcribed) onto mRNA which leaves the nucleus and enters the cytoplasm where it attaches to the ribosome. The information on the attached  mRNA is  decoded and read ( translated) by transfer RNA (tRNA) which then brings corresponding amino acids to the ribosome to be linked together to form the protein. 


7 0
3 years ago
What keeps earth’s temperature at the proper level for life
nikklg [1K]

Answer:

greenhouse gases

Explanation:

all gases whose have three or more greenhouse gases :carbon dioxide (CO2), methane (CH4) and water vapor (H2O)

8 0
3 years ago
In assembling a nucleosome, normally the …(1) histone dimers first combine to form a tetramer, which then further combines with
Readme [11.4K]

Answer:

option 1

Explanation:

In assemblying the nucleosome, this reaction occurs in two main steps. the H3 and H4 are recruited first to the DNA in pairs forming the H3/H4 tetramer; meaning two of H3 and two of H4. This gives rise to the nucleosome precursor. Then after this, the dimers of both H2A/H2B are recruited to this precursor, to give rise to the octamer structure around which the DNA is wrapped.  

7 0
3 years ago
What is the role of auxin in plants​
Sophie [7]

Answer:

Auxin is a key regulator of plant growth and development, orchestrating cell division, elongation and differentiation, embryonic development, root and stem tropisms, apical dominance, and transition to flowering

Explanation:

Hope this helps you

3 0
3 years ago
Read 2 more answers
Who is generally given institutional responsibility for deciding if an individual researcher is properly trained to perform anim
poizon [28]

Answer:Institutional Animal Care and Use Committees ( IACUC).

Explanation: it was formally introduced in 1986 with an amendment to the Animal Welfare Act and corresponding changes in U. S. public health service policy. It is the committee that investigates researcher to know if they are properly trained to perform animal procedures, as required by law.

6 0
3 years ago
Other questions:
  • What are positive impacts of algae? How is it used?
    11·1 answer
  • What is the correct term for pertaining to the ring of muscles between the ileum and the cecum?
    11·1 answer
  • How does the carbon atom complete its octet?
    12·1 answer
  • How can an injury to a peripheral nerve cause loss of both sensory and motor functions?
    6·1 answer
  • True or false do hair follicles divide very quickly
    8·2 answers
  • What is the composition of a DNA fragment?
    8·1 answer
  • Which of the following conditions are required for natural selection?
    5·2 answers
  • Need help biology i have no clue
    9·1 answer
  • Please answer asap!
    7·2 answers
  • Read about the life cycle of an apple tree, and think about the role apples play in reproduction. Describe how apples help apple
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!