1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
How do scientists study earthquakes and what information might be provided?
dmitriy555 [2]

Seismometers and Seismographs

4 0
3 years ago
How many amino acids will be in the polypeptide produced by the normal DNA/mRNA sequence
aniked [119]
The number of amino acids that will be in the polypeptide chain produced by the normal DNA or MRNA sequence is usually 30 amino acids. Although the number of amino acids depends on the function of the generated DNA or RNA. The types of amino acids also differ depending on the function. 
7 0
3 years ago
How are resilience and biodiversity related to the stability of an ecosystem?
Oksi-84 [34.3K]
The more biodisverse the ecosystem it is, the more niches are occupied, and the more resilient it is for issues that can occur, the ecosystem can be more stable
8 0
3 years ago
PLEASE HELP QUICK! Number the organisms from 1 (most abundant) to 8 (least abundant)
DENIUS [597]

Answer:

Mammals, Mollusks, Roundworms, Arthropods, Flatworms

Explanation:

7 0
3 years ago
What would happen if there were no germ-line mutations or genetic recombination possible in a population? (2 points) Genetic var
barxatty [35]
Germ-line mutations are mutations that would be passed down to future generations, and recombinations are where the information each parent passes down to the offspring is shuffled. 

The genetic variation would have to come from random events: False
Only alternate generations would express any genetic variable: False
Body cell mutations would be the only source of heritable genetic variation: False
There would be no new heritable genetic variation possible in the population: True
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is correct? a)All animals share a common ancestor. b)Sponges are diploblastic animals. c)Eumet
    11·1 answer
  • What are the correct labels for this diagram of glucose catabolism
    14·2 answers
  • What role do electron carrier molecules play in photosynthesis?
    14·1 answer
  • When assessing for fluid collection in the lungs during auscultation of lung sounds, you should:?
    7·1 answer
  • What are the advantages of sexual reproduction over asexual reproduction?
    8·1 answer
  • 3. which animal is the carnivore or secondary consumer
    15·1 answer
  • Why does the energy decrease as you go up an energy pyramid
    13·1 answer
  • Allen pours water into a graduated cylinder. He notices that the surface of the water is curved, as shown below.
    10·2 answers
  • Which situation is a result of crossing-over during meiosis?
    7·1 answer
  • A que se le llama patrón <br><br>​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!