1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

Please help this is late. I don’t understand it.

Biology
1 answer:
iragen [17]3 years ago
7 0

Answer:

Bro I got you the whole answer key i had done this before. MARK AS BRAINLIST PLZ:)

Explanation:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

You might be interested in
Telophase is a stage of a cellular process that begins after the chromosomes have moved to opposite poles of the cell. During wh
Dmitry [639]
Answer - D. Mitosis (Confidently Correct)

Reasoning - Its basically the process when the chromosomes move during the ends of each section. Until then it becomes closed into a new cell.

6 0
3 years ago
Read 2 more answers
Which epithelial layers arise(s) from the endoderm?
Morgarella [4.7K]
The embryonic endoderm<span> develops into the interior linings of two tubes in the body, the digestive and respiratory tube. the </span>lining<span> of the follicles of the thyroid gland and the</span>epithelial<span> component of the thymus (i.e. thymic </span>epithelial<span> cells). Liver and pancreas cells are believed to </span>derive<span> from a common precursor.</span>
7 0
3 years ago
Why are cells called the building blocks of an organism?
mrs_skeptik [129]

Answer:

They are called the building blocks of an organism because  all living things are made up of billions of cells that can reproduce, build and change that's why it is called the building blocks of all living things.

Explanation:

7 0
3 years ago
Instructions: Using what you have learned in the lesson and additional research, describe how the theory of evolution is support
olya-2409 [2.1K]

Answer:

fossils depict how our bones have changed from past year to today.

Explanation:

for example, wisdom teeth were use to eat raw meat and crush bones as shown in fossils like Lucy. Another example would be extinct animals preserved, they were not able to survive and adapt to the earths changing conditions.

7 0
3 years ago
Sunlight includes three types of light. Describe each one
dusya [7]

Answer:

Visible light, ultraviolet light and infrared light

3 0
3 years ago
Read 2 more answers
Other questions:
  • How will you compare the heart pump model and the human heart?
    14·1 answer
  • In Liepmann's theory of left-hand apraxia, the MOST likely location of the lesion would be:
    5·1 answer
  • When working with materials during a scientific investigation it is important to understand the meaning of common safety symbols
    13·1 answer
  • Of the pH values below, which is considered "neutral" pH? A. 7.4 B. 9 C. 5.4 D. 7
    6·1 answer
  • What term is used to describe a species whose population is rapidly decreasing and may disappear completely?
    5·2 answers
  • You decide to halve the time you spend in the shower each day and to turn off the water while you’re brushing your teeth and was
    7·1 answer
  • How do these effects on the gene pools lead to speciation
    11·1 answer
  • Plants lose water from their above ground surfaces in the process of transpiration. Most of this water is lost from stomata, mic
    10·1 answer
  • True or false: Selective breeding has been used to produce crops with greater yields.
    8·1 answer
  • How does carbon dioxide affect sea urchins
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!