1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
15

Help!!!

Biology
2 answers:
maria [59]3 years ago
5 0

Answer:

A warmer climate

Explanation:

Anettt [7]3 years ago
4 0
A a warmer climate because of the carbon dioxide in the atmosphere.
You might be interested in
Blocks of genetic material that do not recombine and are passed on for generations are called.
Shkiper50 [21]

Answer:

haplotypes

Explanation:

7 0
2 years ago
What is the value of 200 Kelvin in the Celsius scale of temperature?
Readme [11.4K]

Answer:

Option (c) is the correct answer.

Explanation:

It is known that if we have to convert temperature from kelvin to degree celsius then we have to subtract 273 from the given value of temperature.

Whereas when we have to convert temperature from degree celsius to kelvin then we have to add 273 in the given value of temperature.

Therefore, convert value of 200 Kelvin in the Celsius scale of temperature as follows.

              Temperature = (200 - 273) degree celsius

                                     = - 73 degree celsius

Thus, we can conclude that value of 200 Kelvin in the Celsius scale of temperature is - 73^{o}C.

7 0
3 years ago
Read 2 more answers
How many neutrons does an element have if its atomic number is 46 and its mass number is 166?
jolli1 [7]

To find the number of neutrons in an atom, you subtract the atomic number (number of protons) from the atomic mass (aproximate weight of an atom = neutrons + protons). Therefore the number of neutrons is:

166 - 46 = 120


Hope it helped,


BioTeacher101

6 0
3 years ago
The major structural difference between chromatin and chromosomes is that the latter are
labwork [276]

Answer:

The major structural difference between chromatin and chromosomes is that the latter are more organized and condensed.

Explanation:

Chromatin is genetic material packaged into a complex by special proteins (histones). That complex is in the form of uncoiled structures, so chromatin fibers are long and thin. Chromatin structure is permissive to DNA replication, transcription and recombination events.

On the other hand, chromosomes are highly condensed structures of genetic material that are formed just before the cell division.

5 0
4 years ago
Which of following correctly matches the protein isolation step with its result. Group of answer choices homogenization: breaks
Ronch [10]
If you add 1-1 it is zero
6 0
3 years ago
Other questions:
  • The bonds or interactions that hold together adjacent nucleotides in the sugar-phosphate backbone of dna are
    12·1 answer
  • Please help me!! I will mark brainlest!!
    11·1 answer
  • Show the energy of Oxidation of two mole pyruvic acid.
    5·1 answer
  • Mass spectrometry demonstrated that a bacterial protein and one section of a eukaryotic protein had amino acid sequences that we
    9·2 answers
  • Which number indicates the number of atoms of each element in a molecule of a substance?
    7·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Name a characteristic that helps an animal survive in the tundra.
    9·2 answers
  • During the wintertime the total number of hours of sunlight decreases what effect would this have on the process of photosynthes
    7·1 answer
  • Why are individuals in many developing countries susceptible to diseases such as
    12·2 answers
  • The deepest parts of the ocean are hostile to life. A barren stretch of sea floor recently experienced an earthquake that opened
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!