1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
7

A mutation causes some of an animal's target cells to form without receptors for local regulators. What is most likely to happen

to the affected target cells based on this error?
They will compensate for this error by taking in excess nutrients from their surroundings.
They will develop normally by receiving signals from neurotransmitters instead.
They will not be able to interact with hormones released by the pituitary gland.
They will not be able to multiply in response to growth factors given off from nearby cells.
Biology
2 answers:
Neko [114]3 years ago
6 0

Answer:

They will not be able to multiply in response to growth factors given off from nearby cells.

Explanation:

gladu [14]3 years ago
3 0

Explanation:

Answer:

DNA is composed of two side-by-side chains (“strands”) of nucleotides twisted into the shape of a double helix. ...

The bases are attached to the 1′ carbon of each deoxyribose sugar in the backbone of each strand. ...

The association of A with T and G with C is through hydrogen bonds

You might be interested in
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
I don’t know this pls help I’ve never learned this
FrozenT [24]

Answer:

1-They have their own DNA, which is separate from the DNA found in the nucleus of the cell. 2- both organelles use their DNA to produce many proteins and enzymes required for their function. 3- A double membrane surrounds both mitochondria and chloroplasts, further evidence that each was ingested by a primitive host.

Explanation:

8 0
3 years ago
2. How can dominance and expression of alleles explain the differences between these fraternal twins?
Rasek [7]

Answer:

Fraternal twins are from two seperate eggs.

Explanation:

The first part of the question is missing but any difference between fraternal twins can be explained by the fact that two seperate eggs are fertilized during the pregnancy so they have different genomes which leads to having different dominance of different genes and this leads to different expressions of this genes.

I hope this answer helps.

3 0
3 years ago
2. How is a virtual autopsy different from a regular autopsy? How are they similar?
podryga [215]
This is the answer

please mark me brainliest i’m trying to get to the next rank

3 0
4 years ago
Read 2 more answers
Question 1 of 10<br> 5 Points<br> What is the term for heat transfer because of direct contact?
HACTEHA [7]
The term for heat transfer because of direct contact is conduction.
3 0
3 years ago
Other questions:
  • A cell contains Select one: a. one kind of enzyme that promotes thousands of different chemical reactions. b. thousands of diffe
    10·1 answer
  • The body uses two types of digestion, mechanical and chemical, to break down food into small components. Mechanical digestion ph
    8·2 answers
  • When lin receives a flu vaccination, it reduces the chance of him receiving the flu as well as the chance that his sister will g
    13·1 answer
  • The belief that the experiences of women and men differ as a result of differences in anatomy is called:
    15·2 answers
  • What tropic hormone stimulates cortisol from the adrenal gland?
    11·1 answer
  • Why do cells need carrier protiens that transport glucose
    9·1 answer
  • Evaluating a person's food intake using food records is one of the ways nutritionists determine what people eat and their nutrie
    14·1 answer
  • How do limiting factors most affect population size?
    12·2 answers
  • In a using the template DNA below, transcribe an mRNA strand 3’-TAC AAG TGT CGC ACT-5’
    9·1 answer
  • Can u name one plant whose no part goes waste?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!