1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
14

What are tissues made of?

Biology
2 answers:
notsponge [240]3 years ago
7 0

Answer:

C. Groups of cells

Explanation:

They are made up of cells. When they are formed together, they carry out specific functions.

castortr0y [4]3 years ago
5 0

Answer:

C

Explanation:

A tissue is made up of lots of the same type of cells

You might be interested in
Sort the given molecules into organic and inorganic substances.
Yuki888 [10]

C3H2H4- Imidazole-Organic compound

AlBr3-Aluminium bromide- Inorganic

C6H5F-Fluorobenezene-Organic

Cro3-chromic acid-Inorganic

H2O2-Hydrogen peroxide-Inorganic

C12H22O11-Sucrose- organic

Basically when a compound contains carbon atom in it its said to be organic.

3 0
3 years ago
Read 2 more answers
What is transcription and why is it important in making proteins
Nostrana [21]

Answer:The goal of transcription is to make a RNA copy of a gene's DNA sequence. For a protein-coding gene, the RNA copy, or transcript, carries the information needed to build a polypeptide (protein or protein subunit). Eukaryotic transcripts need to go through some processing steps before translation into proteins.

Explanation:

4 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
1. I have a pattern that calls for 2.5 yards of fabric. How many feet do I need? (Answer: 7.5 feet)
CaHeK987 [17]
You have written the answer 7.5feets
4 0
3 years ago
Transmission of microbes by direct contact includes: a.drinking contaminated water. b.touching a contaminated countertop. c.inha
Romashka [77]

Answer:

B is correct

Explanation:

5 0
3 years ago
Other questions:
  • An important characteristic of antibacterial drugs is their selective toxicity. if antibacterial drugs were not selectively toxi
    7·1 answer
  • Why is the oceanic crust more dense than the continental crust?
    14·1 answer
  • Imagine a person is in a car accident and suffers a sever physical injury. The
    9·1 answer
  • _____ is a common nutrition-related sign or symptom of early pregnancy that occurs in many healthy pregnant women. question 19 o
    13·1 answer
  • Identify the following sample.
    12·2 answers
  • Evidence of evolution 1. make drawings to explain the difference between homologous and analogous structures. 2. define vestigia
    15·1 answer
  • Which 2 body systems work together to transport oxygen to cells?
    7·1 answer
  • View the diagram below and answer the question.
    13·1 answer
  • What is natural selection and what are ifs effects on allele frequencies
    8·1 answer
  • Two functions of the anther and why it attracts insects.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!