1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
2 years ago
6

Why are dogs color blind?

Biology
1 answer:
Luba_88 [7]2 years ago
7 0

Answer:

It is caused by abnormalities in color-detecting molecules, known as cones, in the retina.

I hope this will help you

You might be interested in
Which statement best expresses the central idea of the first paragraph?
Gemiola [76]

Answer:

B

Explanation:

6 0
3 years ago
Which is a negative consequence of using DNA technology in forensics?
Fittoniya [83]

Answer:

hope that helps!!!!!!!!!!!!!!!!!!!!

7 0
3 years ago
Read 2 more answers
Which of the following statements best describes the major difference between prophase I of meiosis and prophase of mitosis?
kirill [66]

A. In prophase I, tetrads of homologous chromosomes form and crossing over occurs

hope this helps :)

5 0
3 years ago
Read 2 more answers
Are chromosomal mutations beneficial , harmful , or neutral?
Rashid [163]

Answer:

Nuetral

Explanation:

There are bad mutations, but there are good mutations. Its all a part of natural selection.

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • How are nondisjunction and polyploidy related?
    5·1 answer
  • Help! will mark if answered asap and correctly
    11·1 answer
  • All life must maintain an internal balance, despite environmental changes.
    10·2 answers
  • What special characteristic of the respiratory membrane facilitates gas exchange?
    8·1 answer
  • You should never depend on your mirrors when you prepare to change lanes. why?
    12·2 answers
  • A thin membrane stretching across the ear canal is the
    12·1 answer
  • Cell that forms in fertilization<br><br> a. gene<br> b. mitosis<br> c. meiosis<br> d. zygote
    12·2 answers
  • Many states and local authorities are requring cars to have their emission
    15·1 answer
  • Why do the ospring of meiosis result in greater genetic variation than the ospring of mitosis?
    7·1 answer
  • How many cells are in each phase of the cycle? *picture* *need all 5 stages*
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!