1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
5

What two elements have the same number of energy level (shells)?

Biology
1 answer:
melomori [17]3 years ago
7 0

Answer:

Elements that are found in the same horizontal row (belong to the same period) in the periodic table, e.g. Fluorine and Neon both have the same energy level of 2.

<em>Note: The question does not specify any two elements.</em>

Explanation:

The modern periodic table is organized into eight vertical columns known as groups and seven horizontal rows known as periods. The atomic number ( number of protons in the nucleus) of elements increases when moving across the periodic table from left to right. The horizontal rows or periods represents an energy levels or the number of electron shells in an element. Energy levels (also called electron shells) are fixed distances from the nucleus of an atom where electrons may be found. Elements belonging to the same period have the same number of energy level or shells. For example, the elements belonging to Period 2 include lithium, beryllium, boron, carbon, nitrogen, oxygen, fluorine and neon. These all have the same number of energy level of 2.

You might be interested in
What of the following is ordered from LARGEST to SMALLEST? Select one: a. virus, mitochondrion, hemoglobin, glucose, water molec
choli [55]

Answer:

c. mitochondrion, virus, hemoglobin, glucose, water molecule

Explanation:

The mitochondrion is a membrane which is found in cytoplasm of eukaryotic cells. It is also known as power house of cells. This is largest from virus, hemoglobin, water molecule and glucose.

Virus is second largest and is small infectious agent. It has capability to infect many organisms and living cells. Hemoglobin is protein which is present in red blood cells. Glucose is a type of sugar presence in the blood. Water molecule is composed of hydrogen and oxygen and is smallest among the others.

3 0
3 years ago
HELP PLEASE!!!!What are the different types of limiting factors found in nature?
balu736 [363]
There are both physical and biological limiting factors found in nature.

-Physical factors (abiotic factors) include temperature, water availability, oxygen, salinity, light, food and nutrients.

-Biological factors (biotic factors) involve interactions between organisms such as predation, competition, parasitism and 
herbivory.
4 0
4 years ago
Which organelles do both plant and animal cells have in common?
My name is Ann [436]

Answer:

nucleus, cytoplasm, mitochondria

Explanation:

5 0
3 years ago
Read 2 more answers
Moldy bread! Where did that come from? Moldy bread indicates that a fungus is growing in and on your bread. But how did it get t
mestny [16]
The answer is (B) Mold spores are in the air around us. Settled on the bread when it was unwrapped.
3 0
3 years ago
Read 2 more answers
Please help!!!! very confused pt 2
Schach [20]

Answer:

If the genotype of the parents are <em>Iᵃi </em>and <em>I</em>ᵇ<em>i, </em>then four type of offspring will be produced.The genotype of the offspring are, <em>IᵃIᵇ, Iᵃi,Iᵇi, </em>and <em>ii.</em>

Explanation:

<em>IᵃIᵇ = </em>As the alleles are co-dominant in nature, so both type of alleles are expressed. The blood group will be AB. So, both A and B type of antigen will be found in plasma membrane of RBC.

<em>Iᵃi= </em>In this type of genotype only A type of antigen will be expressed in the membrane of RBC. The blood group will be A type.

<em>Iᵇi= </em>In this type of genotype only B type of antigen will be expressed in the membrane of RBC. The blood group will be B type.

<em>ii= </em>This is a recessive type of genotype. So, no antigen will be found on the membrane of the RBC. And the blood group will be O type.

The offspring's ratio will be 1:1:1:1.

4 0
3 years ago
Other questions:
  • "when treating a patient who experienced a pulmonary blast injury, you should"
    6·2 answers
  • Which of these nutrients can you get from eating whole fruit that is not usually found in juice?
    11·1 answer
  • The constant, dynamic process of continual addition of new bone tissue (bone ____________ ) and removal of old bone tissue (bone
    14·1 answer
  • In cellular respiration, the organelle where the chemical reactions occur is the _____.
    11·2 answers
  • A spinning turbine can only generate electricity in the form of a/an ____current
    8·1 answer
  • Does corn release more CO2 at night or day
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is NOT an example of nitrogen fixation?
    9·2 answers
  • What is your favorite food? Why? Explain
    14·2 answers
  • When something appears blue, it is absorbing all colors except.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!