Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
The correct option is : "Golgi apparatus"
What is endoplasmic reticulum?
Endoplasmic reticulum (ER), a continuous membrane structure in biology, is vital for the synthesis, folding, modification, and transport of proteins. It forms a series of flattened sacs within the cytoplasm of eukaryotic cells. An endoplasmic reticulum can be found in all eukaryotic cells (ER). The ER typically makes up more than 50% of the cell's membranous composition in animal cells. The two forms of ER, known as rough ER and smooth ER, can be distinguished by differences in certain morphological and functional properties.
Organelle; endoplasmic reticulum Organelle; endoplasmic reticulum
Tomonori Naguro and Pietro M. Motta/Science Source
Due to the ribosomes connected to its exterior (cytoplasmic) surface, rough ER is so named because of its rough look.
Learn more about the endoplasmic reticulum with the help of the given link:-
brainly.com/question/24215999
#SPJ4
(ATP) is comprised of an adenine ring, a ribose sugar, and three phosphate groups.
Answer:
Explanation:
The human ear is the organ for hearing. It converts sound waves into electrical impulses through which the brain processes to facilitate our hearing.
The ossicles inside the ear amplify sound waves they collect from the environment and transmits them into the inner ear.
Once in the inner ear, they are converted into electrical signals the brain can easily understand and discern.
Answer:
Organisms that are more complex, such as eukaryotes, have cells that are specialized for specific functions. Gene regulation needs to be more complex to produce these specialized cells for complex organisms. Please Mark Me Brainliest
Explanation:
