1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
3 years ago
6

Why does wind erode the sand in deserts more than the dirt in forests?

Biology
2 answers:
motikmotik3 years ago
4 0

Answer:

I think the answer is D

Explanation:

the tree roots helps to hold the dirt down plus the higher amounts od mositure make the dirt denser

Katyanochek1 [597]3 years ago
3 0

Answer:Wind is a stronger erosional force in arid regions than it is in humid regions because winds are stronger. In humid areas, water and vegetation bind the soil so it is harder to pick up. In arid regions, small particles are selectively picked up and transported.

Explanation:

You might be interested in
when caring for a female patient who has been sexually assaulted, you should: Select one: a. allow law enforcement to take her s
Amanda [17]
D .............. im pretty sure its this one :)
8 0
4 years ago
What do all ecosystems have ?
Phoenix [80]
I pretty sure that it include both biotic and abiotic. But "C" is wrong. Now your answers are between "A,B and C"
5 0
3 years ago
What occurs at step 3 in the diagram?
Ivanshal [37]

Answer:

A

Explanation:

The restriction enzymes cut the isolated DNA into fragments

5 0
3 years ago
Read 2 more answers
A "tool" is defined as "an instrument or device that is held by the hands and used to perform a particular task or function." Th
Hunter-Best [27]

Answer:

Explanation:

The most primitive tool I used today was the hammer. The hammer is age long in the history of household tools. It is used to hit in nails into walls or woods.

The most advanced tool I have used today is the mobile phone. This is a tool of the 21st century which makes communication easier and faster.

6 0
3 years ago
Almost 50 percent of the carbon dioxide produced by the burning of fossil fuels is stored in the oceans. How does this influence
Feliz [49]
It causes rainfall. It reduces rainfall. It causes global warming. It prevents global warming..
3 0
3 years ago
Other questions:
  • A sheet of paper can be withdrawn from under a container of milk without toppling it if the paper is pulled quickly.
    14·1 answer
  • Phenylketonuria, or PKU, is a recessive genetic disorder in which the amino acid phenylalanine cannot be properly metabolized. C
    5·1 answer
  • How are the principles of probability used in genetics?
    8·1 answer
  • When Darwin wrote on the origin of species he assumed due to the fossil record that species would not evolve quickly since that
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Emma is having a tea party with her stuffed animals and dolls, and pretends that they love the tea and cookies she prepared. Emm
    9·1 answer
  • An experiment that is most appropriate to prove the hypothesis that it rains more in the month of April than in the month of Mar
    6·1 answer
  • Clarence made a diagram to compare codominance and incomplete dominance. Which label belongs in the area marked Y? Neither allel
    7·2 answers
  • What are the four bases of DNA?​
    15·2 answers
  • Which of these has a strong effect on local wind patterns? *
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!