1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
3 years ago
12

DNA vs RNAplease help me! ​

Biology
1 answer:
lesya [120]3 years ago
7 0

number 3

Explanation:

You might be interested in
Which characteristics describe bacteria
nalin [4]

Unique Features. Bacteria lack many of the structures that eukaryotic cells contain. For example, they don't have a nucleus. They also lack membrane-bound organelles, such as mitochondria or chloroplasts.

3 0
3 years ago
Read 2 more answers
What would happen to the concentration of Pyruvate, NADH and intermembrane H+ if Glycolysis stopped working?
gavmur [86]

Answer:

Its Decrease, Decrease, Decrease

Explanation:

I just did it

5 0
3 years ago
Read 2 more answers
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
WILL GIVE BRAINLIEST!!!
Lapatulllka [165]

Answer:

Object A but not object B

8 0
2 years ago
Describe the biotic and abiotic features of the temperate deciduous forests
frez [133]
Living things in the environment such as plants, animals, and bacteria are biotic factors. Biotic factors also include once-living parts such as dead leaves on the forest floor. Abiotic factors are nonliving aspects of the environment such as sunlight, temperature and water. One important abiotic factor is soil.
5 0
3 years ago
Other questions:
  • A un cultivo de células que realizará meiosis se le agrega una enzima que degrada las proteínas del complejo "sinaptonémico", lu
    15·1 answer
  • which of the following can result in a population looking more similar overtime and can be described as selection against both e
    5·1 answer
  • Compare the organelles in a cell to the organs in your body
    10·1 answer
  • Which of these is an environmental effect of deforestation and farming?
    6·2 answers
  • During which process is DNA transferred from one bacterium to another
    8·2 answers
  • A cell has 4 chromosomes. after mitosis, each new cell will have ______ chromosomes.
    9·1 answer
  • Which statement is true of reproduction that
    13·1 answer
  • Lyme disease, rabies, and malaria are mostly spread bya.bites from animals, such as dogs and mosquitoes.b.contaminated foods, li
    10·1 answer
  • GUYS PLEASE HELP
    12·1 answer
  • Speciation on islands is influenced by
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!