In 1838, a German botanist, M.I.Schleiden studied the plant cells and emphasized that "cells are organisms and entire animals and plants are aggregations of these organisms arranged according to definite laws. "In 1839, another German zoologist T. Schwann stated "we have seen that all organisms are composed of essentially like parts namely of cells." The deductions of the two microscopists (Schleiden and Schwann) formed the basis of what came to be known as the cell theory. The cell theory holds that all living matter, from the simplest of unicellular organisms to very complex higher plants and animals, is composed of cells and that each cell can act independently but functions as an integral part of the complete organism.
Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Because bile contains salts and digestive compounds and lipase is a digestive enzyme, you might create a simple qualitative experiment to test the action of bile and lipase. Bile is first used to emulsify and break down food entering the small intestine, and lipase is used afterwards by the pancreas to break down fats. With this information, I suggest this experiment:
1) Label 4 test tubes A, B, C, and D. Divide the fat solution equally into the 4 tubes.
2) In tube B, add an x amount (but not the whole volume) of the bile solution.
3) in tube C, add a y amount (but not the whole volume) of lipase solution.
4) in tube D, add the x amount of bile and the y amount of lipase solution.
5) Swirl/mix until everything looks homogenized/settled.
6) tube A is your control. Compare the 3 other tubes to it and write observations. You should be able to make conclusions about the role of bile in digesting a fatty solution, and the extent of digestion with and without the additional lipase.
Hope this is helpful!~ There are certainly many other possible experiments.
A division by fission followed by Endogenous spore formation, characteristics of the Schizosaccharomycetes.
The parasites multiply in two ways (a) by Binary Fission, and (b) by multiple division or segmentation .
- hOpe that this has helped you anyy COMMENT BELOWW IN IT DIDN"T .
The Centrosome is the organelle responsible for organizing the cell into two parts in preparation for cell division. It develops the spindle fibers used in cell division.
The solution is B.
