1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korolek [52]
3 years ago
6

Which of the following best describes the effect the moon has on the tides?

Biology
1 answer:
Anit [1.1K]3 years ago
5 0

Answer:

A The gravity of the moon pulls the ocean, which causes the tides.

Explanation:

Well all of the other answers are just completely different.

if the moon is invisible tides cannot be seen, but why is it at night it is called high tide. B is very odd because many surfing events happen during the day.

It is A because it contains the most context, because it is the only reliable and realistic option, because when the moon is up, and the sun is down, it causes stronger waves

You might be interested in
Help i need help with this question
ki77a [65]

Answer:

B, E are true

Explanation:

The process of respiration produces energy for organisms by combining glucose with oxygen from the air. During cellular respiration, glucose and oxygen are changed into energy and carbon dioxide. Therefore, carbon dioxide is released into the atmosphere during the process of cellular respiration.

A is false because respiration also happens in plants and is best at night (light not present)

B is true because during the reaction co2 is produced as waste

C is false because co2 is a waste product not a reactant

D is fals because o2 is a reactant not a product

E is true because the whole point of respiration to to produce energy (ATP)

F is false because this occurs in plants aswell

5 0
3 years ago
I ask for help as quickly as possible please and thank you
atroni [7]
Question 1 is nucleolus and other chromatins (chromosomes), nuclear bodies, nuclear matrix, nucleoplasm, and nuclear envelope. Question 2 is Lysosomes are membrane-bound organelles found in every eukaryotic cell. They are widely known as terminal catabolic stations that rid cells of waste products and scavenge metabolic building blocks that sustain essential biosynthetic reactions during starvation.
8 0
2 years ago
Which of the following is an example of the current impact DNA technology has on human health?
Xelga [282]

Answer:plants grow

Explanation:te she said so

8 0
3 years ago
Explain the role of enzymes as biological catalysts that lower the activation energy of a reaction.
tia_tia [17]

Answer:

Enzymes are one kind of protein which functioning as catalyst  that speed up reactions by lowering activation energy.Enzyme accelerate a reaction without altering its chemical equilibrium.

Explanation:

Energy which is required for  start a biochemical reaction is called activation energy.Activation Energy helps to jump and start a thermodynamically favorable reactions.

Enzymes can  many  way to its activation energy.

1. The enzyme may hold the substrates in such a way as to distort the substrate bonds closer to their form in the transition state. This reduces the amount of energy needed to complete the transition.

2.Enzyme create a charge distributor which opposite of transition state his lowers the energy of the transition state and decreases the activation energy.

3.The enzyme may reduce the reaction entropy   by bringing substrates together in the correct orientation to react.

4. The enzyme may provide a completely different chemical pathway for the reaction. It may form new bonds in the ES complex that would be difficult to form without the enzyme.

6 0
3 years ago
Gravity is the force of ______ between all objects.
Rudiy27

Answer:

Gravity is a force of attraction that exists between any two masses, any two bodies, any two particles. Gravity is not just the attraction between objects and the Earth. It is an attraction that exists between all objects, everywhere in the universe.

or just mass.

The Law of Universal Gravitation states that the force of gravity acts between all objects in the universe that have mass.

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Giraffes have long necks that allow them to eat leaves in trees. What characteristic of life is this most directly an example of
    9·2 answers
  • What structures are parts of the central nervous system? Select all that apply.
    8·2 answers
  • if a DNA molecule contains guanie nucleotide base on one chain, the other chain of the double helix will contain a corresponding
    9·2 answers
  • You have isolated a mutant strain of Bacillus subtilis (which you designate wimP) whose endospores can be killed by boiling wate
    11·1 answer
  • What are five different levels of organization studied by ecologist?
    10·1 answer
  • In the illustration below the darkest part of the earth is experiencing
    6·2 answers
  • Are skeletal muscles prokaryotic or eukaryotic
    11·1 answer
  • Fossils reveal the body structures of ancient organisms. What other information is LEAST
    9·1 answer
  • Pls help I will give brainliest
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!