1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
9

A border collie breeder raised border collies for herding cattle. She has 50 dogs, and lets them breed randomly. She has noticed

that some of her puppies are being born with blue eyes. None of her parents have blue eyes. Out of 150 puppies born this year, 35 had blue eyes which is a recessive trait. How many of the other puppies are likely to be carriers of the gene?​
Biology
1 answer:
Svetach [21]3 years ago
7 0

Answer:

20?

Explanation:

You might be interested in
Nick is researching why baking powder is a common baking ingredient. He learns that baking powder contains tartaric acid and sod
Artemon [7]

Answer:

A. Carbon dioxide gas forms because an acid and a carbonate react.

8 0
4 years ago
What term is used to describe the
Elza [17]
B. population density

Explanation: took Biology
8 0
3 years ago
Read 2 more answers
Hotspots are plumes of magma that originates deep below the ______. with respect to overlying plates, these plumes can remain __
rusak2 [61]

The hotspots are regions, where the plumes of magma are present just below the lithosphere. The plume of the magma is the particles of the volcano and the gases, which is erupted during the volcanic eruption. It is generated by the fragmentation of the magma. Once, it reaches the lithosphere, it get spreaded laterally.

The plumes at the hotspots are present just below the tectonic plates, a high temperature r heat and the low pressure causes the rocks present in the lithosphere to melt resulting in volcanic eruption. At hotspot, the melting of rock takes time, sometimes it is very slow, due to the presence of various tectonic plates. Hence, the plumes can remain stationary for a very long period of time without erupting.

So, the first blank can be filled with Lithosphere and the second blank can be filled with Stationary.

7 0
4 years ago
Can you please help me
Zanzabum
I can't help u bc I don't know this sorry
5 0
3 years ago
Read 2 more answers
George is heterozygous for his long hair but Greta has short hair. What are the chances of having a baby guinea pig with short h
Goryan [66]

Answer:

ik this is probably too late, better luck next time lol. There is a 50 percent chance of a baby with short hair

Explanation:

6 0
3 years ago
Other questions:
  • Pillbugs are placed in a container where they have a choice of a wet or a dry environment. Researchers record how much time was
    5·1 answer
  • the surface areas of four solutes are 2 mm2, 6mm2, 10mm2, and 4mm2 which solute will dissolve the quickest
    10·1 answer
  • True or false. pesticides can be derived from synthetic chemicals and from natural materials.
    13·1 answer
  • A researcher is interested in screening for p-elements inserted into a region on chromosome 3. to produce new insertions, she cr
    11·1 answer
  • The protein-containing fluid within lymphatic vessels:
    15·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • How does natural selection affect undesirable traits?
    5·1 answer
  • True or False: Neurotransmitters are released from the axon end of a neuron
    8·1 answer
  • What is the term used for population moving into an area ?
    6·1 answer
  • A farmer plants peas. When he harvests his plants, he observes that all of the green peas (seeds) produced by his plants are rou
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!