1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
14

Scientific knowledge is always changing. At one time, the kingdom was the

Biology
2 answers:
Naddika [18.5K]3 years ago
8 0

Answer:

D

Explanation:

Organisms can be separated into different classifications due to many differences phenotypically or genetically. As we have progressed, research has shown differences allowing us to see bacteria and archaea as different organisms.

mixer [17]3 years ago
8 0

Answer:

d

Explanation:whater

You might be interested in
1. True or False: Bacteria are larger than human cells.<br> lisa<br> Fe<br> True<br> False
dusya [7]
This answer would be false
4 0
3 years ago
A smoker sees his doctor because he had a persistent cough for months and is short of breath after very little exertion. what di
koban [17]
Caused by the body clearing out the chemicals that enter through the airways and lungs through tobacco use. Leads to a variety of other conditions like bronchitis, higher risk of bacterial and respiratory infections, emphysema, COPD, and lung cancer
Hope this helps you!
4 0
3 years ago
Chromosomes are found in the (i)__________ of every living cell. They can be seen by (ii)__________ a cell that is about to (iii
rusak2 [61]

Answer:

Explanation:

i) nucleus

ii) mitosis

iii) split

iv) pairs

v) number

vi) 46

vii) 23

viii) 7

ix) 127

x) arm

7 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Choose any one of the consumer services companies and write an essay of about 500 words on how a diverse economy such as the Uni
zaharov [31]

Answer:

let's take the example of Walmart, which has the large presence in the United States and is an important part of the Consumer Services Industry.

Explanation:

Walmart began with just one store but has grown all over the country to many unique aspects of the American economy and demographics. The United States, in contrast to what many people assume, is a very diverse country.

The culture of New England is very different from that of the Bible belt. Similarly, the African American culture of Georgia is different from the casual California where there is a vast Hispanic population.

Walmart saw an opportunity in this diversity and has grown by catering to needs of all these consumers. Communities with highly dense Hispanic population stocked food items that were very different than can be found in Jewish neighbourhoods and vice verse.

This enabled Walmart to connect with each community and grow with them over the generations.

In all this, Walmart prides itself in providing benefits to US army veterans and provides jobs to women from low-income backgrounds and the disabled.

In all this, Walmart does face a number of different challenges, including:

A slowing economy can hit the profits of the company

Competition from other companies such as Costco and even international players like Aldi and Lidl can decrease their market share

Online rivals such as Amazon have long been identified as a threat to the company and is one of the biggest challenges facing the consumer service industry.

Companies like Amazon are not only involved in retail but also in selling movies, music, etc that can completely challenge the consumer service sector

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which substances are most commonly used as building blocks in the synthesis(making) of some lipids
    13·2 answers
  • Which of the following helps to safeguard biodiversity?
    11·2 answers
  • 1) The main difference between a prokaryotic cell and a eukaryotic cell is
    15·1 answer
  • How are fossils used to date organisms?
    15·1 answer
  • What are offspring from a cross between two different plants called?
    12·2 answers
  • What makes the lines that are the "fingerprints" on an electrophoresis gel?
    9·2 answers
  • All vertebrates have bilateral symmetry and a true coelom. At the base of the phylogenetic tree, neither sponges nor cnidarians
    5·1 answer
  • A student conducted an investigation to study phototropism in grasses. The only difference between the control group and the exp
    7·1 answer
  • For separate ecosystems to be classified as the same type of biome they must
    14·1 answer
  • How many cells does one gram of yeast contain? ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!