1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
3 years ago
12

Multicellular organisms from least complex to most complex

Biology
1 answer:
Molodets [167]3 years ago
8 0
<span>cell, tissue, organ, and the organ system.</span>
You might be interested in
During what stage of mitosis do chromosomes separate
german

Answer:

Anaphase

Explanation:

During Anaphase the chromosomes separate and move along the spindie fibers to opposite ends of the cell.

4 0
3 years ago
. In which phase of cellular respiration is glucose a substrate?​
vodka [1.7K]

Explanation:

During glycolysis, enzymes act on the substrate, glucose. Glycolysis occurs in the cytoplasm; here, 2 molecules of ATP are used to cleave glucose into 2 pyruvates,  4 ATP and 2 electron carrying NADH molecules.

Further Explanation:

In all eukaryotic cells mitochondria are small cellular organelles bound by membranes, these make most of the chemical energy required for powering the biochemical reactions within the cell. This chemical energy is stored within the molecule ATP which is produced. Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’ or Citric acid cycle via the oxidization of pyruvate( through the process of glycolysis in the cytoplasm).

overall: C6H12O6 (glucose) + 6 O2 → 6 CO2 + 6 H2O + ≈38 ATP

Oxidative phosphorylation describes a process in which the NADH and FADH2 made in previous steps of respiration process give up electrons in the electron transport chain these are converted it to their previous forms, NADH+ and FAD. Electrons continue to move down the chain the energy they release is used in pumping protons out of the matrix of the mitochondria.

This forms a gradient where there is a differential in the number of protons on either side of the membrane the protons flow or re-enter the matrix through the enzyme ATP synthase, which makes the energy storage molecules of ATP from the reduction of ADP.  At the end of the electron transport, three molecules of oxygen accept electrons and protons to form molecules of water...

  • Glycolysis: occurs in the cytoplasm 2 molecules of ATP are used to cleave glucose into 2 pyruvates,  4 ATP and 2 electron carrying NADH molecules.
  • The Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate,  2 ATP oxygen molecules, 8 NADH and 2 FADH2.
  • The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2,  renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.

Learn more about cellular life at brainly.com/question/11259903

Learn more about cellular respiration at brainly.com/question/11203046

#LearnWithBrainly

5 0
3 years ago
Which part of the brain controls body movements and processes information from the sense organs? (1) Cerebral cortex. (2) Pons.
Ulleksa [173]
The part of the brain that controls body movements and process information from the sense organs is : 1. Cerebral Cortex

Basically, Cerebral cortex is the part of the brain that control all conscious movement of your body

Hope this help
5 0
3 years ago
Read 2 more answers
What type of igneous rock has two distinct grain sizes, indicating two stages of cooling?
Sholpan [36]
It is C Porphyritic ;)
3 0
2 years ago
which of the following levels of protein organization shows the complete 3D arrangement of the polypeptide chain
kherson [118]

Proteins are the macromolecules made of hundreds of amino acids. Proteins are most varied class of biological molecules and show the greatest variety of structures. Many have detailed three-dimensional folding patterns that result in a compact form, but others do not fold up at all and they are in random conformations. The function of proteins depends on their structure.

The secondary structure of protein fold together to form the 3D arrangement of a polypeptide chain that results into Tertiary structure which is a functional protein.    


4 0
3 years ago
Other questions:
  • Bulimic nervosa is foremost __________? an excessive like of food an excessive appetite an excessive dislike of food none of the
    6·1 answer
  • Four friends were talking about human DNA, genes, and chromosomes. They each had different ideas about where these structures we
    8·1 answer
  • What is a fungus?<br> Describe what would happen if fungi did not exist.
    5·1 answer
  • Which evolutionary process involves the slow addition of allelic variation that increases the hereditary diversity of population
    8·1 answer
  • Traditionally, evolutionary studies are done with DNA. For the miRNA lab, you are going to observe RNA rather than DNA. How can
    12·1 answer
  • Enzyme A is currently functioning at a temperature of 55 and a pH of 7. According to the information provided in the chart, sele
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which planets are considerably larger
    10·2 answers
  • How do you know something is dead
    9·2 answers
  • Why does darkness affect the light-independent reactions of photosynthesis?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!