1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
8

Which of the following is NOT true about the FemCap cervical cap?

Biology
1 answer:
Kazeer [188]3 years ago
5 0

Answer:

Explanation:

it must be kept in place at least 10 hours after intercourse

You might be interested in
Which is happening as humans emit more carbon dioxide into the atmosphere?
Mazyrski [523]
<span>As humans cause more carbon dioxide to be released into the Earth's atmosphere, it causes the oceans to become much more acidified which in turn begins to damage the precious coral reefs. Roughly one quarter of all the life in the ocean is dependent on coral reefs for food and shelter.</span>
3 0
3 years ago
What is stimulated by high extracellular fluid volume (ECFV) and works to increase GFR and urine output?
r-ruslan [8.4K]

Stretching of the atrial muscle cells releases a hormone called atrial natriuretic factor (ANF). ANF relaxes the juxtaglomerular (JG) cells of the afferent arteriole and thereby increases GFR and urine output.

3 0
3 years ago
Which of the following is NOT a characteristic of animals ?
777dan777 [17]

Answer:

The answer is "A"

Explanation:

They cannot make their own food, they are heterotrophs

7 0
3 years ago
Why do we want to turn genes off or on?
Dmitrij [34]

The process of turning off and on of genes is known as gene regulation.

Explanation:

When the gene is turned on, it instructs the cells to construct a particular protein. The proteins are the molecules that build your body with collagen, tendons, and bones or keratin in your hair.

The gene regulatory proteins allow the individual genes of an organism to be turned on or off . in different cell types there are different selections of gene regulatory proteins. The patterns of the gene expression gives each cell its unique characteristics.

Each cell produces or turns on only a fraction of its genes. the remaining genes are repressed or turned off. this process is known as gene regulation. The signals from the environment or from other cells activate proteins called transcription factors.

3 0
3 years ago
The vastus medialis provides a _____ pull on the patella when contracting concentrically.
OverLord2011 [107]
The word that best fits the statement is the term "superolateral." The vastus medialis is located at the quadriceps muscles wherein it is the most medial among the muscle groups. It is specifically placed at the top portion of the muscle just above the knee. 
6 0
3 years ago
Other questions:
  • 8) The plasma membrane is composed of a double layer of molecules called
    5·1 answer
  • Compare and contrast the polyp and medusa stages of a typical jellyfish.
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What type of plague are there in the world
    12·1 answer
  • What kind of energy heats our water?
    12·2 answers
  • What statement is true about the distribution of water on earth
    10·1 answer
  • I’ll mark brainliest
    7·1 answer
  • 2 reasons why someone might selectively breed cats<br><br> Other then to stop allergies
    8·1 answer
  • Marta is running. Sam is sitting in a chair.
    12·1 answer
  • Gregor Mendel discovers that ____________________________________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!