1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
7

Pls help me with this!!!

Biology
2 answers:
levacccp [35]3 years ago
6 0

Answer:

1. ( c)

2. (A)

3. (b)

Explanation:

prokaryotes have no nuclues and are unicelluar while Eukaryotes are multicellular with nucleus

san4es73 [151]3 years ago
4 0
C,A,B in exact order hope this helps :)))
You might be interested in
Which is the DNA tehory? How do we know the DNA contains genetic information?
ValentinkaMS [17]

DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base. The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions, or genetic code. Human DNA has around 3 billion bases, and more than 99 percent of those bases are the same in all people. DNA sequencing theory is the broad body of work that attempts to lay analytical foundations for determining the order of specific nucleotides in a sequence of DNA

6 0
3 years ago
At what phase of mitosis does the amount of genetic material in each chromosome become half of what it just was?
wlad13 [49]
This is happen during anaphase when two chromatids separate and move towards opposite poles,
7 0
3 years ago
What type of tissue has cells that are tightly packed
IgorLugansk [536]

Answer:

The answer would be the epithelial tissue.

Explanation:

4 0
3 years ago
Read 2 more answers
What’s the difference eve between atp and adp?
Arturiano [62]

Answer:

d

Explanation:

ATP stands for Adenosine Tri Phosphate, and that third phosphate is bonded to the other two with a very high energy bond, so a lot of energy is released when that bond is broken. When the third phosphate is removed from ATP, you get ADP, which stands for Adenosine Di Phosphate.

5 0
3 years ago
Read 2 more answers
. If it is June or July and you live in the southern hemisphere, describe the position of the Earth, in relation to the Sun, and
irga5000 [103]
It would be their equivalent of winter. The lower half of the Earth would be tilted away from the sun, and so it would be colder
6 0
3 years ago
Other questions:
  • In three to five sentences, explain why sickle cell disease became so prevalent in certain East African populations.
    8·1 answer
  • What is the general name of an enzyme that transfers phosphate groups from atp to a protein?
    5·1 answer
  • What characteristics distingueshes fungi from other organisms
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • PLEASE HELP I WILL GIVE YOU ALOT OF POINTS<br> How are infectious agents transmitted?
    13·2 answers
  • Which of the following was one of the purposes of the Gemini project?
    6·2 answers
  • In radishes, the gene that controls color exhibits incomplete dominance. Pure-breeding red radishes crossed with pure-breeding w
    5·1 answer
  • What do you mean by derived unit ? Give example?​
    14·1 answer
  • “The movement of cytoplasm is due to the movement of chloroplasts in the living cells of onion plant”, “while the movement of ch
    6·1 answer
  • The primary responsibility of the pelvic and hip region is ______________ during ___________ chain motion.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!