1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
13

You get home from school and grab a bag of potato chips before settling onto the couch to binge watch your newest Netflix series

. A few hours later, you notice that all of the chips are gone and you feel very thirsty. You get up to go to the bathroom before grabbing a drink and notice your urine is exceptionally dark in color. Apply what you know about osmosis to explain what has happen to the cells in your body. Include the name for the type of solution the cells were in after eating and how the cells attempted to maintain homeostasis despite these salty conditions.
Biology
1 answer:
snow_tiger [21]3 years ago
3 0

Answer:

Explanation:

Osmosis is the process in which the molecules of a solvent move from a region of low concentration to a region of higher concentration through a semi-permeable barrier.

While eating the chips, <u>the salt content from the chips makes the surrounding solution of the cells to have an increase in salt concentration causing an hypertonic solution</u>. An hypertonic solution is a solution that has more solute (salt) than the (solute in a) cell. <u>This increase in salt concentration around the cells causes the cells to release water to neutralize the high salt concentration in the solution around the cell (in order to maintain homeostasis)</u> which causes dehydration in the individual and hence making the individual to be thirsty. <u>The body attempts to maintain balance by passing this excess salt out of the body in the form of urine hence the reason for the dark colour in the urine </u>(because if the body doesn't rid itself of the high salt concentration, the cells could shrink and die as a result).

You might be interested in
14.2 how can a small change in a person's dna cause a genetic disorder
Mademuasel [1]
A small change in a persons DNA can cause any number of mutations that may be completely harmless or fatal depending on where the mutation (change) occurs in ones DNA.
4 0
3 years ago
Read 2 more answers
A complete transection of the spinal cord will result in
Anvisha [2.4K]

The acute spinal cord injury can result due to a traumatic injury, which can either result in a complete teat known as a transection or may result in a bruise known as a contusion. The spinal cord injury generally occurs in young adults and men.

The transection of the spinal cord may result in areflexia and spinal shock. It can also result in flaccid paralysis of all skeletal muscles, loss of sensation, loss of spinal reflexes, and lack of autonomic function below the level of injury.

3 0
3 years ago
Most animals produce offspring through mating, but some organisms reproduce by cloning. What is cloning?
Brums [2.3K]
The correct answer is the third option! the third option is the literal definition of cloning
6 0
3 years ago
Read 2 more answers
What did Mendel discover about genetic factors in pea plants?
jenyasd209 [6]
Menda discovered the fundamental laws of inheritance. Which mean that he made a conclusion that genes come in pairs & are inherited as distinct units. (One gene from each parent)
7 0
3 years ago
What is genomic imprinting?
puteri [66]

Answer:

genomic imprinting, process wherein a gene is differentially expressed depending on whether it has been inherited from the mother or from the father. Such “parent-of-origin” effects are known to occur only in sexually reproducing placental mammals.

7 0
3 years ago
Other questions:
  • What is the importance of the phosphorus cycle??
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The______ the silica content and the _______ the dissolved gases, the more explosive a valcano will be
    10·1 answer
  • The types of organisms living on Earth have changed significantly over time due to various factors. What important event occurre
    7·1 answer
  • James Watt observed that a horse could raise a____, pound weight about 1 foot each second
    11·2 answers
  • Identify the correct order, from highest satiety value to lowest, of the following. Identify the correct order, from highest sat
    12·1 answer
  • The ______ promotes the development of businesses focusing on clean energy. environmental protection agency (epa) clean energy i
    13·1 answer
  • What are the characteristics of the vertebrate's nervous systems?
    8·1 answer
  • PLEASE, help The diagram below represents a chloroplast found in a typical plant cell.
    10·2 answers
  • What are similarities of hurricanes and thunderstorms
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!