1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
3 years ago
6

The cell membrane is a lipid bilayer but a cell has only one membrane. which organelles in this lesson have a double membrane?

Biology
1 answer:
mina [271]3 years ago
7 0

Answer:

The mitochondria have a double membrane. They help in respiration.

Explanation:

You might be interested in
Which part of a plant has the potential to produce a lateral shoot?
Dmitry [639]
The auxillary bud has the potential to produce a lateral shoot.
8 0
3 years ago
What is the kingdom of unicellular prokaryotes that have cell walls with pept idoglycan?
Dmitry [639]

Answer:

Eubacteria

Explanation:

5 0
3 years ago
A scientist is testing a new plant food to see if it causes plants to grow faster. The scientist tests two plants with the new p
SashulF [63]
The independent variable is the new plant food
6 0
3 years ago
A woman produces an egg with 24 chromosomes, including 2 copies of chromosome 21. If the egg is fertilized by a normal sperm, th
Zielflug [23.3K]

Answer:

47

Explanation:

We all know that gametes like egg cell and sperm have haploid set of chromosomes but here as per this question she has produced 2 copies of chromosome 21. For the sake of maintaining haploidy, she was supposed to have only a single copy of chromosome 21 as a result of which her egg cell was supposed to have 23 chromosomes not 24.

But, this is a case of non dis-junction. Also, in a normal sperm there are no such copies of any chromosome i.e. there is a haploid set of chromosomes. It means that sperm must be having only 23 chromosomes. So we can easily infer that when the egg cell and sperm will fuse, the zygote will have 47 chromosomes (24 from egg cell and 23 from sperm).  

6 0
3 years ago
Which of the following statements are safety guidelines that must be followed during this lab? Check all that apply.
Ymorist [56]

Answer:

The first three are the correct choices. The last is wrong

Explanation:

Hope this helped Mark BRAINLEST!

6 0
3 years ago
Read 2 more answers
Other questions:
  • What sre the proportions of clay, silt, and sand shown at point B in figure 5-1
    13·1 answer
  • Ancient rift valleys and deep caves often contain human fossils that can provide clues about human evolution and the lives of ou
    15·1 answer
  • Does when food is eaten affect weight gain? a study was introduced that examined the effect of light at night on weight gain in
    14·1 answer
  • How photosynthesis can affect living organisms on earth and ocean
    14·1 answer
  • How do humans use their genes to produce more than 22,000 proteins?
    15·1 answer
  • A gallon of Moo Milk costs $6.40. $<br> is the price, in dollars, of an 8-ounce glass of Moo Milk
    13·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Name the main chemical responsible for pollen tube growth
    11·2 answers
  • Answers
    15·1 answer
  • Which statement is not a part of the cell theory
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!