1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
9

What is photorespiration? Why is it bad and why does it occur?

Biology
1 answer:
tekilochka [14]3 years ago
4 0

Answer:

In cellular respiration it is a positive term, a process vital to life. But photorespiration is an entirely negative term because it represents a severe loss to the process of using light energy in photosynthetic organisms to fix carbon for subsequent carbohydrate synthesis.

Explanation:

You might be interested in
which tool enhances a scientist’s senses? a microscope a calculator a test tube a stirring stick
VLD [36.1K]
Microscope, hope this helped.
6 0
3 years ago
Read 2 more answers
Which of the following characteristics does an arthropod have?
Natalija [7]

-Presence of jointed appendages and gills, lungs, jaws.
-Presence of a chitinous external skeleton or exoskeleton that change periodically.
-Body constituted by repetitive segments, phenomenon known as metamerism<span>.</span>

<span>I hope this help,</span>

<span>                       Sebastian Goicoechea.</span>

6 0
3 years ago
I GOVE BRAINLIEST!!!
disa [49]

Answer:

Meiosis is important because it ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes . Meiosis also produces genetic variation by way of the process of recombination .

Explanation: Meiosis is important for three main reasons : it allows sexual reproduction of diploid organisms , it enables genetic diversity , and it aids the repair of genetic defects .

Plss follow me and Mark as brainlest

5 0
3 years ago
Read 2 more answers
How do animals get rid of excessive nitrogen?
lesya [120]

Answer:

Animals get rid of nitrogen by converting it int urea uric, acid and ammonia.

Explanation:

6 0
3 years ago
Read 2 more answers
How can humans reduce<br> the impact of a storm surge?
Xelga [282]

Explanation:

reducing the impact Global climate change may result in increased storm surge flooding in some areas, through intensification of the cyclones driving the storm surges and as a result of sea level rise. Mangroves can reduce storm surge water levels by slowing the flow of water and reducing surface waves.

8 0
3 years ago
Other questions:
  • Think of the shape of a wave. It looks like a squiggly line. We know the highest part of that line is the peak. The wavelength i
    5·2 answers
  • 7 Which must be true of any scientific hypothesis? *
    9·2 answers
  • Mutations within an organism can occur in body cells or reproductive cells. Which type of mutation is seen in a sperm cell but n
    13·2 answers
  • When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In ancient times, plant and animal remains got buried, compressed, and transformed into fossil fuels like coal. Burning of these
    11·1 answer
  • Why is water called a universal solvent?
    6·2 answers
  • An organism grows in colonies and is composed of eukaryotic cells, in which domain does this organism belong?
    9·1 answer
  • Where does lipid digestion take place?
    10·1 answer
  • Pls help me on this science question
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!