1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elina [12.6K]
3 years ago
11

Examples of anti biotics ​

Biology
1 answer:
stealth61 [152]3 years ago
5 0
  • Ibuprofen
  • amoxicillin.
  • doxycycline.
  • cephalexin.
  • ciprofloxacin.
  • clindamycin.
  • metronidazole
You might be interested in
Can someone please help me on this !
Arisa [49]

To find an angle you use a variable like x or y. Sincw its a straight angle, it would be x +103 = 180. then you would subtract 103 on both sides. then you'll get x= 77 degrees

7 0
3 years ago
Which describes the reproduction of plants?
Otrada [13]
Asexual reproduction that produces a zygote
6 0
2 years ago
Compared with a eukaryotic cell, a prokaryotic cell Select one:______
juin [17]

Answer:

The correct option is a. lacks organelles beyond ribosomes.

Explanation:

All cells of higher organisms are bounded by a cell membrane (also called plasma membrane or plasmalema) and contain cytoplasm that surrounds one or more nuclei. Within the cytoplasm there are structures known as organelles, which are specialized in carrying out the metabolic processes of the cell, these cells are called eukaryotes. The prokaryotes are smaller, lack a differentiated nucleus and organelles. The prokaryotic cells are not internally divided by membranous walls, but consist of a single space.

Both prokaryotic and eukaryotic cells contain ribosomes. Ribosomes are organelles not delimited by membranes, these organelles are important since a cell makes all its proteins in its ribosomes.

8 0
3 years ago
Please select all that apply!
Andrews [41]
C The rods will attract each other because they are both positively charged.
8 0
2 years ago
Read 2 more answers
Which of the organisms listed is most likely to contain genes encoding enzymes that can fix carbon from co2?
Dimas [21]

There are a few different organisms that could potentially contain genes encoding enzymes that can fix carbon from CO2. However, one of the most likely candidates would be plants. Plants have a unique ability to convert CO2 into useful organic compounds, and they typically have a large number of genes encoding enzymes involved in this process. Therefore, it is reasonable to believe that plants may also have genes encoding enzymes that can specifically fix carbon from CO2.

<h3>How do plants convert CO2 into useful organic compounds?</h3>

Plants are able to convert CO2 into useful organic compounds through the process of photosynthesis. This process occurs in the chloroplasts, which are organelles found in the plant cells. In photosynthesis, the plant uses sunlight to convert CO2 and water into glucose and oxygen. The glucose can then be used by the plant for energy, while the oxygen is released into the atmosphere.

To learn more about photosynthesis, visit:

brainly.com/question/1388366

#SPJ4

3 0
1 year ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Explain the process of mitosis in a tissue culture for normal cells.
    14·1 answer
  • PLZ HELP!!! 50 POINTS!!
    7·2 answers
  • temperature. Imagine that when a bacterial cell carrying such a mutation is shifted from low to high growth temperatures, RNA po
    14·1 answer
  • The nurse is teaching a group of nursing students about acute glomerulonephritis genitourinary conditions. a student asks the ab
    7·1 answer
  • The diploid number of chromosomes in the mustard plant, Arabidopsis thaliana, is 10. Knowing this, answer the following question
    10·1 answer
  • Without the presence of sea otters, sea urchins would otherwise overgraze kelp beds, dramatically changing the marine community
    9·2 answers
  • El nombre de 10 animales y 10 plantas usando las normas de Carlos linneo
    8·1 answer
  • A student observes a small disc-like green organelle in a plant cell. Which organelle is the student most likely viewing?
    9·2 answers
  • When the motion energy of an object changes there is inevitably some other change in energy at the same time. If an object is sl
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!