1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
11

Please help me I will give you the brain thing and extra points. image below

Biology
1 answer:
Sphinxa [80]3 years ago
8 0
The second on :” the number of valence electrons stays the same” because a valence electron is the number of electrons on the outer shell of the atom and if it’s in group one then the outer shell of any element will have one electron on its outer shell
You might be interested in
I need help I am stuck on this problem
Lady bird [3.3K]
Where's the question
6 0
3 years ago
How are photosynthesis and cellular respiration related?
Margarita [4]

I'd go with the third one because the products of both of them are oxygen and carbon dioxide.

8 0
3 years ago
Read 2 more answers
Looking at the Punnett square, what are the possible genotypes and frequencies
Rom4ik [11]

Answer:

50% or 1/2 of the children will be heterozygous.

50% or 1/2 of the children will be recessive hom0zygotic.

Explanation:

7 0
3 years ago
_____is an interaction between species that affects both species negatively (-/-), as they utilize similar resources.
jolli1 [7]

An interaction between species that affects both species negatively (-/-) , as they utilize similar resources is called as Competition .

Competition :

Competition is a process in which the fitness of individual of one species is significantly lower than that of the individual of same or different species.

Types of competition :

For the necessities of life , it is divided into two types .they are as follows,

A) interspecific competition : it is a competition which occurs between the individuals of two different species having some requirements of life , e.g.,carnivorous animals such as tiger ,lion ,leopard etc .compete for the prey . in the forest habitat ,herbs and trees compete for sunlight , water space , minerals , and biological pollinators .

If the individuals of two different species have sme one or more requirement the the competition becomes very severe e.g., grassland is the common habitat for bison ,dear rabbits ,rats grasshoppers , etc .if thee is short supply of grass due to draught then the competition becomes severe

The survival of the consumers is determined by the quantity of grass required by each species ,ability to change the food and its capacity to migrate to new localities.

B) Intraspecific competition : it occurs between the individuals of the same species .this type of competition is very severe as all the individuals of the same species have almost common requirement of food ,habit etc .besides they also exhibits similar adaptations to fulfill their requirements ,e.g., animals of same species compete for water ,food and mates .

Intraspecific competition is the driving force behind evolution and natural selection .

Thus the Competition only negative impact on environment.

Learn more about Competition here:

brainly.com/question/28202938

#SPJ4

7 0
1 year ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Other questions:
  • based on the fact that people can get cancer regardless of their genetics, what are some things you can do to lower your risks o
    10·1 answer
  • RNA primer constructed during DNA replication needs to be replaced because RNA differs from DNA. It contains_______ instead of__
    13·2 answers
  • Is there an evolutionary benefit to high metabolism?
    11·1 answer
  • The flora (plants) and fauna (animals) found on the bottom of any body of water are called what?
    8·1 answer
  • In pea plants, purple flowers are dominant over white flowers. The phenotype ratio of purple to white flowers in a population of
    6·1 answer
  • Suppose that an error in transcription alters the formation of a single trna molecule in a cell. the altered trna still attaches
    15·1 answer
  • I don’t understand this. Please help.
    6·1 answer
  • Why does the chair in which you are currently sitting retain its same shape over time?
    12·1 answer
  • January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequen
    10·1 answer
  • Describe the two types of ions
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!