1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zina [86]
2 years ago
6

What are nutrients and water absorbed by?

Biology
1 answer:
beks73 [17]2 years ago
8 0

Answer

Your lower intestine of your body

You might be interested in
A geneticist crossed fruit flies to determine the phenotypic ratio. The geneticist crossed a fly with blistery wings and spinele
kondor19780726 [428]

Complete question:

A geneticist crossed fruit flies to determine the phenotypic ratio. The geneticist crossed a fly with blistery wings and spineless bristles (bbss) with a heterozygous fly that had normal wings and normal bristles (BbSs). Which proportion of offspring that are dominant for both traits in would you not expect based on Mendel's law of independent assortment? 1/2 , 4/16, 25% , or 1/4

Answer:

1/2 is the proportion of the offspring that is NOT expected among individuals that are dominant for both traits.

4/16 = 1/4 = 25% of the progeny and the correct expected proportion of individuals that are dominant for both traits.

Explanation:

<u>Available data</u>:

  • Cross:  a fly with blistery wings and spineless bristles with a heterozygous fly that had normal wings and normal bristles
  • Recessive trait: blistery wings and spineless bristles
  • Dominant trait: normal wings and normal bristles

Let us say that:

  • B is the dominant allele for normal wings
  • b is the recessive allele for blistery wings
  • S is the dominant allele for normal bristles
  • s is the recessive allele for spineless bristles

Parentals)        bbss       x        BbSs

Gametes)  bs, bs, bs, bs     BS, Bs, bS, bs

Punnett square)    BS        Bs         bS        bs

                     bs    BbSs    Bbss     bbSs    bbss

                     bs    BbSs    Bbss     bbSs    bbss

                     bs    BbSs    Bbss     bbSs    bbss

                     bs    BbSs    Bbss     bbSs    bbss

F1)  4/16 = 1/4 = 25%  of the progeny is expected to be BbSs, dyhibrid individuals, expressing normal wings and normal bristles

     4/16 = 1/4 = 25% of the progeny is expected to be Bbss, expressing normal wings and spineless bristles

     4/16 = 1/4 = 25% of the progeny is expected to be bbSs, expressing  blistery wings and normal bristles

     4/16 = 1/4 = 25% of the progeny is expected to be bbss, expressing  blistery wings and spineless bristles    

5 0
3 years ago
The bottom line difference between passive and active transport through a cell membrane’s is
Ahat [919]
<h3><u>Answer;</u></h3>

Active transport uses energy and passive transport does not

<h3><u>Explanation</u>;</h3>
  • <u>Passive transport occurs when materials move across cell membranes without using cell energy (ATP). </u> Examples of passive transport include; diffusion, facilitated diffusion, and osmosis. It moves small molecules like water, oxygen, carbon dioxide and glucose.
  • <em><u>Active transport on the other hand involves the movement of materials across the cell membrane that requires the use of cell energy (ATP)</u></em>.
  • In other words the difference between active transport and passive transport is that passive Transport moves ions from high concentration to low, using no metabolic energy while active Transport moves ions from low concentration to high, using metabolic energy in the form of ATP.
8 0
2 years ago
14. what are the genotypes of the brown and yellow labs who have all black puppies? show all your work using punnett squares.
Varvara68 [4.7K]

There are two different genotypes of brown labs and three different genotypes of yellow labs (eeBB, eeBb, and eebb) (Eebb and EEbb).

Let's examine genotypes, a different table now: As a result, a brown or yellow lab couple can have both brown labs and black or yellow labs.In actuality, neither brown nor chocolate dogs are permitted. Only yellow puppies can ever be born to a yellow lab couple. Even stranger, two brown labs can have yellow or brown puppies, whereas two black labs can have yellow or black puppies. Only yellow labs are capable of independently producing several shades of colour.

Learn more about  genotypes by using this link:

brainly.com/question/12116830

#SPJ4

7 0
1 year ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What protein is responsible for the initial step in unwinding the DNA helix during replication of the bacterial chromosome?
maw [93]

Answer:

Proteins play a fundamental role for life and are the most versatile and diverse biomolecules. They are essential for the growth of the organism and perform a huge amount of different functions.

The passage of DNA to proteins begins with the step of transforming genetic information into an intermediary between DNA and protein. This intermediary is called messenger RNA (mRNA). The difference between DNA and mRNA is that the second corresponds to a very small fraction of all DNA, consists of a single chain (it is no longer a “zipper” but a strand), and that Thymine (T) is replaced by the Uracil (U). This fraction corresponds to the stretch of DNA that contains the sequence necessary to ultimately synthesize the protein.

8 0
3 years ago
Read 2 more answers
Other questions:
  • How could increasing the number of plants help you decrease error in the experiment? Check all possible reasons.
    9·2 answers
  • What is unusual about mitochondrial DNA?
    5·1 answer
  • PLEASE HELP ASAPPP !!! 15 PTS !!!
    12·2 answers
  • Which statement best describes the composition and function of proteins in organisms?
    7·1 answer
  • Work id done on a ball when a soccer player kicks it. Is the player still doing work on the ball as it rolls across the ground?
    15·1 answer
  • I need a picture that explains how proteins are made.
    6·1 answer
  • Theophrastus was considered the father of botany in the approximately year
    9·2 answers
  • A woman who isn't colorblind but has an allele for color blindness reproduces with a man who has normal vision. What is the chan
    12·2 answers
  • Which is the answer ?
    11·1 answer
  • What provides evidence of an increase in animal species at the same time that atmospheric oxygen concentrations increased?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!