Answer:
Homologous pairs of chromosomes are lined up independently of other such pairs during <u>metaphase I.</u>
Explanation:
Meiosis is a special type of nuclear division that occurs only in organisms with sexual reproduction. The meyotic division gives rise to gametes.
The division begins just after the chromosome DNA has replicated in the S phase. Each chromosome is made up of two identical sister chromatids joined by their centromere. However, chromosomes are not kept separate in the nucleus, but instead bind to their homologous partners. This union called synapse, occurs during prophase I.
In metaphase I, the pairs of chromosomes are aligned in the spindle Ecuador, that is, during this stage, the homologous pairs are aligned in the metaphase plate (which is the equatorial plane of the achromatic spindle) for separation.
During anaphase I, the members are directed to the opposite poles of the cell. Telophase I, this phase begins with the arrival of chromosomes at the poles and with the formation of a nuclear envelope around each group of chromosomes. During Profase II, the nuclear membrane (if formed during Telophase I) dissolves, and spindle fibers appear.
The first meyotic metaphase and anaphase is usually completed in a short time to give rise to the phases of the second division (metaphase II and anaphase II) , which is a mitosis during which the centromeres divide and the chromatides move towards opposite poles to become gamete chromosomes. In telophase II, cytokinesis separates cells.
If there was a larger population of rabbits than dandelions, and the rabbits only ate the dandelions, they would eventually run out. then the rabbits would start to die too, since their main food source is gone.
Answer:
A. single-gene
Explanation:
It is controlled by a single gene that has two alleles. The allele for a widow's peak is dominant over the allele for a hairline with no peak.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
from precipitation, oceans lakes streams and soil
