1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
3 years ago
14

DNA is a polymer built of many monomers. What is the monomer unit used to build a DNA molecule?

Biology
1 answer:
lara31 [8.8K]3 years ago
5 0

Answer: Nucleotides, Let me know if it was right. :)

You might be interested in
How do feedback signals affect the cell cycle ?
iris [78.8K]

Answer:

The cyclins activate the CDKs, which affect the cell cycle at three important checkpoints: Late in the G1 stage of the cell cycle, triggering the cell to move into the S phase.

Explanation:

5 0
3 years ago
What are the similarities between recessive and dominant alleles
Readme [11.4K]

-  they are both found in the same place

-  they are both passed down to newer generations

-  both of them can determine your traits

8 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
State the role of mirror​
kvv77 [185]

Answer:

Mirrors are essential to every home. They help us in our daily mundane lives, though we rarely ever really appreciate their usefulness. From the moment we get up at night to the time we ready ourselves for sleep, we almost always seek for a mirror to take a look at ourselves. Mirrors reflect to us how we look, how clothes fit us, and how things fit.

Explanation:

3 0
3 years ago
20
Reil [10]

When tissues are harmed by bacteria, trauma, heat, or any other cause, an inflammatory reaction occurs.

<h3>What happen when a honey bee stings?</h3>

When a honey bee stings or a disease infects damaged cells, chemicals are released. chemicals are a group of substances that include prostaglandins, histamine, and bradykinin. These substances promote swelling by forcing blood vessels to leak fluid into the tissues.

During the inflammatory reaction, the following processes occurred:

Redness, swelling, and loss of function are all symptoms of heat.

Inflammation is the body's natural defense system. Damaged cells, irritants, and infections are recognized by the immune system, white blood cell kills the antigen and stimulates the other defense cell to act. this process is called a macrophage.

Learn more about defence system here:

brainly.com/question/22681268

#SPJ1

8 0
2 years ago
Other questions:
  • Which phrase best describes the time period in which the current body of scientific knowledge was developed?
    6·2 answers
  • Which front brings rapidly forming storms
    6·2 answers
  • The human gene egfr located onn chroosme 7 is a proto-oncogene that codes for a growth factor cell surface receptor
    9·1 answer
  • What is the time of year when the suns most direct rays reach farthest north or south
    14·1 answer
  • The lengths of a sample of tiger canines were measured. 68% of the lengths fell within a range between 15 mm and 45 mm. The mean
    6·1 answer
  • All animals need to eat ? To get? To live
    6·2 answers
  • How long is a gestation period for a mouse
    12·1 answer
  • A certain mutation in the gene for hemoglobin results in the red blood cells becoming sticky,
    9·1 answer
  • In the female reproductive tract . fertilization normally occurs in the
    10·1 answer
  • Discuss how the body changed?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!