1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
11

Where do you think the most chloroplasts are found in the plant system—in leaves, the stem, or the root?

Biology
1 answer:
nasty-shy [4]3 years ago
7 0

leaves

Explanation:

Chloroplasts are mostly found in the parts of the plant that are capable of photosynthesis.

You might be interested in
Where would you expect to find green algae? Choose three answers
Andrei [34K]
On rocks in the sun under moving or stagnant water
6 0
2 years ago
Cite evidence that living systems follow the Laws of Conservation of Mass and Energy. How do living systems follow the law of co
kodGreya [7K]

Answer: Living systems use the Law of Conservation of Mass when a living organism dies. When the organism decomposes carbon is released and enters back into the Earth. This follows the law because the mass is not being created or destroyed, but reused. Living systems use the law of conservation of mass when a living organism dies. ... It follows the law because the mass is not being created or destroyed, but reused. Living systems use the law of conversation of energy when an organism decomposes

Explanation:

5 0
2 years ago
Starch is a polymer of ____ subunits?
SpyIntel [72]
Glucose (C6H12O6) subunits
3 0
3 years ago
Topo map ,30 points! !!!
Viefleur [7K]

Answer:

410   500  450

Explanation:

4 0
2 years ago
Which elements or substances do you think are the most important for life as we know it? (Hint: What are the molecules that make
djverab [1.8K]

Answer:

carbon is the main element

Explanation:

Organic compounds make up the cells and other structures of organisms and carry out life processes. Carbon is the main element in organic compounds, so carbon is essential to life on Earth. Without carbon, life as we know it could not exist.

8 0
2 years ago
Read 2 more answers
Other questions:
  • What step in the carbon cycle didn’t exist before the industrial revolution?
    13·1 answer
  • The respiratory system is part of the excretory system?​
    12·2 answers
  • Which scenario describes a mutually beneficial relationship with fungi in an ecosystem? A. Fungus growing inside an anthill
    7·2 answers
  • The substantial-capacity test states that an individual should have the mental capacity to understand that an act is wrong or co
    6·2 answers
  • Compare ocean ridges with fault-block mountains
    8·1 answer
  • What occurs during the G1 and G2 in the cell cycle?
    9·2 answers
  • a rocket launched 200 kilometers in 40 seconds what is the avarage spped of the rocket in kilometers per hour?​
    5·1 answer
  • EXPERT HELP: I'LL GIVE BRAINLIEST:<br><br> Choose TWO statements
    13·2 answers
  • Ill mark brainliest!
    13·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!