1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
8

Can someone help me with 1,2,3

Mathematics
1 answer:
pshichka [43]3 years ago
6 0

Answer:

I think its

1. AC=14

2.x=6

3.x=4

You might be interested in
Can someone please help me on this I don’t understand it.
olga55 [171]

Answer:

x = 3.6

Step-by-step explanation:

1 (4) = 4

0.9 (4) = 3.6

x = 3.6

There is a sequence... adding 0.9 to each side (at different lengths).

4 0
3 years ago
Read 2 more answers
What is the equation of the following line (4 -3) (0 0)
Zepler [3.9K]
The answer is D

If you used the slope formula (y2-y1/x2-x1) you would get a slope of -3/4. 
7 0
3 years ago
Read 2 more answers
Kyle has a storage box that is 2 ft. long, 3 ft. high, and has a volume of 12 ft.3
Eva8 [605]

Alright, let get started.

Kyle has a storage box having dimensions 2 ft long, 3 ft high and volume 12 cubic feet.

The formula for volume is = length * width * height

Suppose the width is w so,

12 = 2 * 3 * w

12 = 6w

Dividing by 6 in both sides

w = 2 feet

Myla has a storage box that is 4 ft high and 2 feet long and volume 16 cubic feet.

Suppose the width is w hence

16 = 4 * 2 * w

16 = 8 w

Dividing 8 in both sides

w = 2 feet

Hence the width of Kyle and Myla's boxes, both are 2 feet. : Answer

Hope it will help :)



8 0
3 years ago
Read 2 more answers
What is 9$ discounted to 4$ in percent form?
faust18 [17]
9 dollars is 4 dollars.
Let's find the percent form of the discount
=> 4 dollars / 9 dollars =  0.44
Now, let's convert it to percentage
=> 0.44 * 100% = 44%
Thus the discount is 44%

4 0
3 years ago
Sara buys 3 of the same type of dress, but in different colors. If she spends a total of $80.34, how much does each dress cost?
Musya8 [376]

Answer:

80.34 / 3 = 26.78


5 0
4 years ago
Read 2 more answers
Other questions:
  • Plz help! I’m super confused! Thank you!
    10·1 answer
  • I need help plz, i dont understand it, its english class, i dont like english class
    15·2 answers
  • Tony's hourly wage is $20 and his net pay is 75% of his earnings. Tony spends about $1,900 on his monthly expenses. If Tony work
    13·1 answer
  • Which statement about the quadratic parent function is true?
    13·2 answers
  • Which expression is equal to (3m)^2/5
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Which equation represents a line that passes through (2,-1) and has a slope of 3?
    11·1 answer
  • What is the measure of angle B in degrees?
    7·2 answers
  • 7a = 28 Is a=21 a solution?<br> yes or no
    5·1 answer
  • Use the discriminant to determine the type and number of solutions.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!