1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
3 years ago
10

Which taxonomic group includes kingdoms and all other levels of taxonomy

Biology
1 answer:
777dan777 [17]3 years ago
4 0
Domains include Kingdoms and all other taxa.
You might be interested in
Morgan obtains a score on a screening device for depression, which indicates the presence of significant depression. Morgan's ps
Allisa [31]

Answer: Recommend further assessment.

Explanation:

Psychologists can usually tell if you have depression by asking you specific questions and doing a physical exam. Psychologists may, however, ask for lab tests to rule out other diagnoses. They will likely do blood tests to check for medical conditions that may cause depressive symptoms.

8 0
3 years ago
Which observation directly illustrates the adhesive properties of water?
otez555 [7]
D. Shows how water molecules attract to the glass tube.
3 0
3 years ago
What types of carbohydrates are made of chains of alpha and beta glucose?
bulgar [2K]
Starch is made up of alpha glucose. Fiber and Cellulose is made up of beta glucose. 
4 0
3 years ago
In addition to properties of elements, list at least two other things or events that are periodic
Sphinxa [80]

Answer:

Periodic: electronegativity, ionization energy, electron affinity, atomic radius, melting point, and metallic character

Explanation:

8 0
3 years ago
Read 2 more answers
I'M GIVING YOU 100 POINTS FOR THIS AND BRAINLY. PLEASE HELP!!!!
natali 33 [55]

only about 3% because all of the other water would have to be filtered incorrect to be safe to drink so the student was incorrect in saying that there was water directly for humans to drink

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which population of organisms would begin the flow of energy through a desert food web?
    12·2 answers
  • The bird and the snake would both be classified as _______________
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Deserts are increasing world-wide. This is known as _____.
    14·1 answer
  • What do the gram stain, acid-fast stain, and endospore stain have in common?
    12·1 answer
  • A 54-year-old woman with a history of osteoporosis has been prescribed ciprofloxacin for recurrent cystitis. because of the pati
    5·2 answers
  • Elements are _____.
    11·2 answers
  • Which does not occur during translation? tRNA pairs with complementary mRNA. A peptide bond is created between amino acids. DNA
    11·2 answers
  • Suppose a person has a small intestine that has a fewer villi than normal. would the person most likely be overweight or underwe
    10·1 answer
  • This image shows a volcanic eruption in Hawaii with lava flowing into the sea.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!