1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
15

What is the term for an atom that decays?

Biology
1 answer:
murzikaleks [220]3 years ago
4 0

Answer:

radioactive

Explanation:

its in physics term

You might be interested in
Why do many diseases such as measles occur only once in a person yet others such as colds occur more than once?
mezya [45]

Answer:

This happens because of our immune system. Our immune system keep record of every attacking microbe. It contains two type of while blood cells firstly is T cell that respond quickly to the attacking microbe. While secondly B cells that recognize those specific cells and fights them off. In addition to that B cells clones itself as memory cells for that disease and will remains in your body for years

3 0
3 years ago
Which of the following correctly describes how molecules move during diffusion? (select all that apply)
BigorU [14]
<span>i think it is a.Molecules move against their concentration gradient.  hope it helps

</span>
5 0
3 years ago
What type of deafness is present if the bone-conducted sound is heard longer than the air-conducted sound?
NNADVOKAT [17]
The type of deafness that is present if the bone conducted sound is heard longer than the air conducted sound is CONDUCTIVE HEARING LOSS.
Conductive hearing loss refers to the situation where there is a problem conducting sound waves anywhere along the route through the outer ear to the ear drum and the tiny bones of the middle ear.
4 0
3 years ago
Give an example of a chemical adaptation. State the name of the organism and describe the adaptation. Discuss how this adaptatio
lesya [120]

Answer:

Answer is explained below;

Explanation:

Adaptation is referred to as a change or mutation that occurs in an organism that helps it to survive in its environment. The three types of adaptations include structural or morphological, physiological or chemical and behavioral adaptations.

  • Physiological or chemical adaptations.

Physiological or chemical adaptations are adaptations that do not show from the outside and are based on the body chemistry and metabolism of organisms which enable them to regulate their body functions and perform certain peculiar functions such as defense mechanisms in order to survive in its environment. Examples include the toxins released by certain plant leaves to repel herbivores, compounds present in the saliva of the mosquito to prevent blood coagulation, the more efficient kidneys of desert animals, etc.

For example, in certain marine organisms that are sedentary or move slowly such as starfish or sea stars, the chemical adaptation helps them to protect from predators. They excrete some chemicals from their skin as a defense mechanism that is harmful to the predators.  

Whales are marine mammals that migrate to large distances and spend most of their time in arctic, tropical or temperate waters. In order to survive these temperature changes, they maintain a constant body temperature that is not dependent on the surrounding water. So, they are called endothermic or warm-blooded animals.

  • Structural (morphological) adaptations.

A change that occurs in the appearance or morphology (structure) of an organism in order to survive in its environment is known as structural adaptations. Examples of structural adaptations include the sharp eyesight of predatory birds,  small ears of Arctic foxes to retain body heat, corky bark of trees to protect from wildfires, etc.

  • Behavioral adaptations

Behavioral adaptations are adaptations that affect the behavior or action of an organism in order to survive in its environment. Examples include birds migrating to warmer winter climates, hibernation of bears to escape the cold, desert animals active at night during hot summer weather, etc.

3 0
3 years ago
The Hardy-Weinberg principle is written as the equation p2 + 2pq + q2 = 1. What does prepresent?
mart [117]

Explanation:

Hardy-Weinberg principle can be illustrated mathematically with the equation: p2+2pq+q2 = 1, where 'p' and 'q' represent the frequencies of alleles. ... The principle behind it is that, in a population where certain conditions are met (see below), the frequency of the alleles in the gene pool will be constant.  

6 0
3 years ago
Other questions:
  • What is the difference between puff pastry and croissant dough?
    11·1 answer
  • What are cells that express the same genes? A. similar B. different C. mutated D. not living
    10·1 answer
  • Considering that millions of species have lived on earth why are there relatively few fossils
    8·1 answer
  • Compared to the tropical rainforests, the temperate rainforests generally have
    6·1 answer
  • 57:23
    7·1 answer
  • The sum of the Genetic traits in a population is called its
    15·2 answers
  • Which of the following is a divergent boundary?​
    8·1 answer
  • What is the function of the glycoprotein molecule in the cell membrane?
    7·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Name the two parts of an ecosystem from which organisms need resources to survive and reproduce?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!