1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
3 years ago
5

PLEASE HELP ME I DONT UNDERSTAND

Biology
1 answer:
Bond [772]3 years ago
3 0

Answer: Does the black sqaure represent disease? If so, emma is #1. As for the others i think i need more context

Explanation:

You might be interested in
A bond of the following elements would be of what type? Na + Cl <br><br> Covalent or ionic
nikklg [1K]

Answer:

ionic

Explanation:

Ionic bond:

It is the bond which is formed by the transfer of electron from one atom to the atom of another element.  

Both bonded atoms have very large electronegativity difference. The atom with large electronegativity value accept the electron from other with smaller value of electronegativity.

For example:

Sodium chloride is ionic compound. The electronegativity of chlorine is 3.16 and for sodium is 0.93. There is large difference is present. That's why electron from sodium is transfer to the chlorine. Sodium becomes positive and chlorine becomes negative ion.

There are one valance electron in sodium so it needed to lose one valance electrons to complete the octet while chlorine needed one electron to complete the octet. Thus electrons lost by sodium atom is gained by atom of chlorine and form ionic compound.

2Na + Cl₂ → 2NaCl

6 0
3 years ago
What is ONE major difference in the problems associated with obtaining measurements on the sizes or densities of animal populati
ratelena [41]

I think one major difference with that is that animals can move around, go distances in search for food or mate, and thus make the animal densities per geography vary greatly. Birds migrate regularly, so their population densities tend to vary with seasons. Their mobility also depends on the availability of food, so animals go away if there are no food in the area.

Plants on the other hand don't move around faster (they can migrate by reproduction: it's their seeds moving around). Thus their densities tend to be more constant per season/life cycle.

4 0
3 years ago
It is the _____________ of climate that makes it so important.
babymother [125]
It is the regularity of climate that makes it so important.
3 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Pick only 5 boxes. No LINK
Marianna [84]

Answer:

nitrogen fixation, nitrification, denitrification, anammox, and ammonification

Explanation:

3 0
3 years ago
Other questions:
  • Help please! Can someone please explain to me how the base pairing rule in DNA works and give an example? (no plagiarism please)
    6·1 answer
  • Why do scientists use significant digits?
    5·1 answer
  • During a football game, a young man suffers an injury to his spinal cord at the first thoracic vertebrate. What major functions
    14·1 answer
  • In an ecosystem where the owls eat mice the carrying capacity of both populations has been reached . how would the migration of
    15·1 answer
  • Hubble's expansion law states _____.
    11·1 answer
  • What is a positive symptom of schizophrenia?
    12·1 answer
  • Explain how the translation portion of the Central Dogma is only true for protein- coding genes. In other words, what are some e
    8·1 answer
  • The sun's energy and composition is provided by which of the following?
    6·1 answer
  • Which statements accurately describe the structure of the cell membrane? Check all that apply. The cell membrane is a single lay
    6·2 answers
  • Brainliest - Answer Quickly
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!