1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
11

2. The genetic material of a virus can either be_____ or ______

Biology
2 answers:
dimulka [17.4K]3 years ago
6 0

Answer: RNA or DNA

Explanation:

katrin [286]3 years ago
4 0

Answer:

RNA or DNA

Explanation:

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Angular Momentum can be expressed
swat32
C. I took the test!!!
3 0
3 years ago
The heat from the bonfire is transferred to the student's hands through the process of
Akimi4 [234]
The heat from the bonfire is transferred to the student's hands mainly, but not exclusively, through the process of RADIATION.


There are three mechanisms or processes of heat transfer: conduction, convection, and ratiation.


Conduction is carreid out by contact; it requires that the two objects are touching each other. This is not the case.


Convection is the heat transferred by the movement of the fluids (liquids ang gases). In some extent this happens in this case, but it is not the dominant effect becasue air is not a very good conductor. Specially if there is not much air movement (wind).



Thermal radiation is carried out by electromagnetic waves. When there is a source of intense heat, like the fire, the heat is propagated by radiation.


Then really, the heat from the bonfire gets to the student's hands by convection and radiation, but as fire is very intense (its temperature is very high), and as long as the air is calmed, the dominant process is radiation.  If there is wind, convection starts to be important.
6 0
3 years ago
Bt corn is a genetically modified crop that contains a gene from another species
Varvara68 [4.7K]
<h2>Answer:</h2>

Bt corn is a genetically modified organism that contains a gene of bacteria known as Bacillus thuringiensis.

<h3>Explanation:</h3>
  • Bt corn is a type of transgenic crop that contains a gene which produces a crystal-like protein which has an insecticidal effect.
  • This gene is present in bacteria. This gene is transferred to the plant by the recombinant DNA technology and genetic engineering.
  • This bacterium is a soil bacterium which has no side effects on humans.
  • Due to use of this technology, the poisonous chemical insecticides are not used in crop production.
5 0
3 years ago
What is the difference between a species that immigrates and a species that is invasive ?
valina [46]

The difference is that species that immigrate don’t hurt nothing around that environment but invasive species hurt things around the environment such as animals plants and other living things

3 0
4 years ago
Other questions:
  • Scientists never say a theory is proven OR not.they only say if the evidence_________ or__________it.
    14·1 answer
  • Suppose scientists decided to harvest the mineral nodules on the sea floor. Identify two environmental problems that might occur
    6·2 answers
  • What role does skin play in the excretory system
    9·2 answers
  • One reason farmers often choose genetically modified crops over non-genetically modified crops because genetically
    15·2 answers
  • Life comes from the <br><br> -Water<br> -Land<br><br> WHICH PLEASE HELP?
    11·2 answers
  • 1)what organs make up the organ system , the circulatory system.
    15·1 answer
  • BRAINLIEST!<br> Define procrastination and list 4-5 ways that you combat procrastination.
    10·1 answer
  • Carnivores that feed on other carnivores are _______. a. tertiary consumers b. secondary consumers c. primary consumers d. produ
    13·1 answer
  • Cool air can hold _______<br> water vapor than warm air.
    7·1 answer
  • Propane is burned to provide the heat in many cooking grills. The chemical
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!