1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
14

Dynamic regulation is required for maintaining homeostasis.Explain how a cellular mechanism that regulates the quantity of a bio

chemical product in a cell resembles the regulation of a heating and cooling system that keeps your room temperature comfortable
Biology
1 answer:
Troyanec [42]3 years ago
8 0

The homeostasis of the human body works like a machine set at a particular standard. If the factors deviate from the standard values, the homeostatic mechanism come into action.

For example, if a cell requires certain protein, the respective genes get a signal and get activated. The cell start synthesizing the protein and when sufficient amount is made, there is a feedback loop, which allows the same protein to stop the synthesis as well. A lot of organs and cellular systems are involved in regulating the synthesis of this protein.

This is similar to the cooling system. If we set the temperature of the cooling system to certain degree, it will start cooling the room till the required temperature is reached. As soon as the temperature is acquired, the system cut-off automatically and the required temperature is maintained.

You might be interested in
Osmosis occurs through water channel proteins called ...
ankoles [38]

Osmosis is a natural phenomenon where molecules move from a lower concentration to a region with higher concentration. This occurs through water channel proteins called Aquaporins. This natural phenomenon can occur in cells which can cause shrinking or bursting. 
3 0
3 years ago
The projections move the prokaryote through its environment is known as ribosome
Marianna [84]

Answer:

Explanation:

DNA is composed of two side-by-side chains (“strands”) of nucleotides twisted into the shape of a double helix. ...

The bases are attached to the 1′ carbon of each deoxyribose sugar in the backbone of each strand. ...

The association of A with T and G with C is through hydrogen bonds

8 0
2 years ago
Read 2 more answers
Create a food web by drawing arrows to show which organisms are eaten by others
Sav [38]

Answer:

sorry if it's a bit messy, hope it helps

8 0
3 years ago
Eating a diet high in ___ can lead to a condition called diabetes.
insens350 [35]
Eating a diet high in sugar can lead to a condition called diabetes.
Hope this helps.
4 0
3 years ago
The harmonic law would suggest that Neptune will take ____ to orbit the sun than mercury.
Juli2301 [7.4K]
Mercury has the smallest orbit and neptune has the largest. so neptune would take a longer amount of time to orbit the sun.
6 0
3 years ago
Read 2 more answers
Other questions:
  • In the chemical compound C2H2, how many pairs of electrons are shared between the two carbon atoms?
    10·2 answers
  • _____ may have evolved as a mechanism that functions prevents individuals from being socially excluded from a group.
    11·1 answer
  • The pH scale has a range of __to__
    5·1 answer
  • Carbohydates are essential in any diet because
    15·1 answer
  • A/an ___________ occurs when a layer of warm air prevents the rising air from escaping. The polluted air is trapped and held clo
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is the difference between an endocrine and an exocrine gland?
    14·1 answer
  • When homologous chromosomes cross over, what occurs?
    11·2 answers
  • People who have Tay-Sachs disease cannot metabolize some lipids effectively. Tay-Sachs is a recessive disorder. A student used a
    6·1 answer
  • The proteases involved in initiating and carrying out programmed cell death are called.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!