1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
7

Describe the path an egg from the ovary to the outside of the female body

Biology
1 answer:
Elis [28]3 years ago
5 0
The ovaries produce the egg cells, called the ova or oocytes. The oocytes are then transported to the fallopian tube where fertilization by a sperm may occur. The fertilized egg then moves to the uterus, where the uterine lining has thickened in response to the normal hormones of the reproductive cycle.
You might be interested in
Consider a closed ecosystem which contains only mosquitoes and frogs. the mosquitoes feed on the blood of the frogs, and the fro
serious [3.7K]
It is impossible as there is a loss of energy between the transfer of energy between flogs and <span>mosquitoes. This ecosystem would never be sustainable or in equilibrium. There is also no primary producer within this ecosystem. No ecosystem can exist without some initial source of energy that would be obtained using solar or chemical energy. For terrestrial ecosystems, plant primary producers would normally provide the initial energy into the ecosystem.  </span>
4 0
3 years ago
_____ are lipids that store energy and are typically composed of multiple building blocks containing three fatty acids attached
marta [7]

Answer:

Fats are lipids that store energy and are typically composed of multiple building blocks containing three fatty acids attached to a glycerol molecule.

Explanation:

Fats, because they are a group of natural molecules that includes fats, waxes, sterols, and fat soluble vitamins.  

5 0
3 years ago
Read 2 more answers
Phenylthiocarbamide (PTC), also known as phenylthiourea (PTU), has the unusual property that it either tastes very bitter or is
faltersainse [42]

Answer: a

Explanation:

A

5 0
2 years ago
Excess carbon gases released into the atmosphere cause additional radiation to be retained and Earth's average temperature to in
sp2606 [1]
Although earthquakes often occur before a volcanic eruption, they are not the cause. The earthquakes are the result of magma (molten rock) moving underground leading up to an eruption. A few volcanic eruptions are thought to have been triggered or initiated by earthquakes, but this is not the typical case.
7 0
3 years ago
Read 2 more answers
A go cart with a mass of 200 is pushed with a force of 1000 N (1000 kg m/s^2). What is the acceleration of the go cart in m/s^2
Solnce55 [7]
If the mass<span> of the object somehow becomes twice as much, its </span>acceleration<span> ... 22) A 10-N falling object encounters 4 N of air resistance. .... 39) A </span>force<span> of 1 N accelerates a </span>mass<span> of 1 </span>kg<span> at the rate of 1 </span>m/s2<span>. ... E) more than </span>1000 N<span>. ..... 88) A ball thrown straight upward takes 10 seconds to </span>go<span> up and return to the ground.</span>
4 0
3 years ago
Other questions:
  • I need help with this question. Anybody wanna help?
    8·1 answer
  • . When biomedical researchers design drugs that must enter cells to be effective, they sometimes add different groups to make th
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Since all living organisms use the same four nucleotides in DNA structure, what is it that makes individuals unique?
    11·1 answer
  • Intracellular digestion occurs when food is digested
    8·1 answer
  • A Hypertonic solution outside of the cell has how much solute compared to the solution inside of a cell?
    13·1 answer
  • True or False? Plants are key in the Carbon Cycle. Plants take in O2 and release CO2 into the Atmosphere.
    7·1 answer
  • What happens when a penny is dropped from a height of 20 meters?
    5·1 answer
  • Why the answer for question 2 is D please give detail explanation and example​
    9·1 answer
  • What would happen to plants if animals didn’t breathe
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!