The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
While plant cells have chloroplasts to photosynthesize, they also require ATP for cellular functions, and do use oxygen to break down some of the sugar they produce in order to generate that ATP. They need mitochondria for this.
In particular, at night when there is no light, plants undergo cellular respiration since there is no sunlight to photosynthesize.
They do, however, produce far more sugar and oxygen through photosynthesis than they use up in respiration.
Answer:
A. Populations tend to increase in size
Explanation:
More people are being born than people dying
Answer:
The nucleus
Explanation:
It's the largest organelle in a cell and holds most of the genetic information
