1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anarel [89]
3 years ago
10

What is the function of the enzyme in the ELISA test? What is it used for? How can you tell a positive and negative result?

Biology
1 answer:
Simora [160]3 years ago
6 0

Answer:

sorry can spell in English

otherwise l will recomment you

You might be interested in
How do the homologous chromosomes compare to each other ?
kotegsom [21]

Answer:

The two chromosomes in a homologous pair are very similar to one another and have the same size and shape. Most importantly, they carry the same type of genetic information: that is, they have the same genes in the same locations.

Explanation:

8 0
3 years ago
Read 2 more answers
Which of these layers will the water move easily? Check all that apply.
Pani-rosa [81]

Hi!


The correct options would be B & E.


Rock and granite are hard and tough materials that are allow very minor seepage of water, which is close to negligible which is why these materials have been employed as construction material in buildings.

Clay is relatively more permeable to water as compared to granite and rock, but still does not allow water to flow through easily as it has a low porosity and permeability to water.

Soil & Organic Layer (fertilizer), allow easy passage of water through them due to high porosity.


Hope this helps!

7 0
3 years ago
Read 2 more answers
Biology definition??
Pavel [41]
The physiology, behavior, and other qualities of a particular organism or class of organisms.
4 0
3 years ago
a purple flower with an unknown genotype is crossed with a white flower how do you determine the genotype if hte purple flower i
andriy [413]
You have already worked out that the white flower must have genotype pp (two recessive white alleles) and that the purple flower could be homozygous (PP) or heterozygous (Pp). 

<span>Now you need to draw Punnet squares for both possibilities and show that the way to determine the genotype is the proportion of purple offspring. If the genotype is PP, then all the progeny will inherit one P and one p, making 100% purple flowers. If the purple flower is Pp, then half will inherit P and half will inherit p, making for half white and half purple flowers in the next generation.</span>
7 0
3 years ago
DNA is copied during a process called ______________________ that uses base-pairing to create a second strand of DNA.
Pavlova-9 [17]
The answer is C. Replication
8 0
3 years ago
Other questions:
  • What is the main function of flowers
    11·1 answer
  • A cell finishing mitosis has __________ dna molecules, while a cell finishing dna replication has __________ dna molecules.
    6·2 answers
  • Some types of atoms form more than one covalent bond with another atom. What determines how many covalent bonds two atoms can ma
    11·1 answer
  • Between glycolysis and the citric acid cycle (also known as
    9·1 answer
  • A 63-year-old woman has been diagnosed with polycythemia vera (pv) after undergoing a series of diagnostic tests. when the woman
    7·1 answer
  • Which technique of detecting GSR holds the most promise for the immediate future?​
    13·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Are the four daughter cells produced by meiosis identical or unique?
    9·2 answers
  • Example of made up negative feedback loop
    5·1 answer
  • 1 State whether the following statements are True or False.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!