1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
13

Which is more harmful to otters and other animals, trapping or pollution /habitat destruction ?

Biology
1 answer:
Vika [28.1K]3 years ago
6 0

Answer:

habitat destruction

Explanation:

it would be hard for them to be able to make another habitat all over again after all of the hard work that was put in to it but yet again trapping and taking away the animal from their family is very hard to

You might be interested in
Give reasons for the following.
sineoko [7]

1. Energy is often considered the “Fuel of Life”. Primarily, it is needed for maintaining basic

metabolism (maintenance energy). Any excess is then used for production of meat (growth)

and/or eggs (production). Fed too much energy, hens become overweight (excess growth)

leading to poor production. If fed too little energy, hens begin using protein to meet their basic

maintenance needs and egg production may be compromised. As is the case with most things

in life, balance is the key. This article is an attempt to provide a flock manager with some tools

to use when making decisions on feeding energy to a breeder flock. Some of the research

cited is not current and is in no way intended to be anything more than an example of the

thought processes that may be helpful when making difficult decisions about feeding.

Energy is essential to meet our most basic needs: cooking, boiling water, lighting and heating. It is also a prerequisite for good health – a reality that has been largely ignored by the world community.

2. Coal and diamond are two examples of carbon allotropes, where the carbon atoms are bonded together in different configurations. These structural differences result in very different material properties, such as hardness.

On its own, carbon cannot form diamonds under the surface of the Earth. Both coal and diamond are made primarily from carbon, but their chemical structures are significantly different. Coal is formed from highly impure carbon that often contains elements like oxygen, selenium, hydrogen, nitrogen and sulfur.

5 0
3 years ago
The diagram to the right shows an HIV particle.
AysviL [449]
Im just gonna say I hope and pray that it’s c:/
6 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Will give brainliest to the correct answer
QveST [7]
Birds-Migratory
Freshwater Fish-local endemic
Large predators-sparse distribution
7 0
2 years ago
Which of the following shows an example of data being collected?
serious [3.7K]

Answer:

C

Explanation:

she is collecting data by counting the number of eggs that were laid

4 0
3 years ago
Other questions:
  • Identify the three main stages of translation
    12·2 answers
  • uring a trip to the supermarket, Jim bought the following items: Bread $1.45 Beans $0.88 Toothpaste $2.90 Milk $3.55 Dog food $6
    11·2 answers
  • What happens if a state’s minimum wage is lower than the federal minimum wage?
    5·1 answer
  • What indicates a positive test for the presence of starch?
    9·1 answer
  • An antenatal G2, T1, P0, A0, L1 client is discussing her postpartum plans for birth control with her health care provider. In an
    14·1 answer
  • Obesity can lead to what disease in which there is excess sugar in the blood
    6·2 answers
  • Which makes fast-moving water a greater force of erosion?
    8·2 answers
  • What happens during the initiation step of DNA transcription? A ribosome attaches to the initiation codon of a completed mRNA st
    10·1 answer
  • The cross Lpq/lPQ x lpq/lpq is carried out and the L gene is found to be in the middle. what would be the geneotype of the doubl
    9·1 answer
  • Two parents who have type AA And Ai blood will have children with which blood<br> type?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!