All categories

3 years ago

Write a difference between compost and green manure

1 answer:

wel3 years ago

5 0

The major difference between compost and green manure lies in their composition. While green manure is made from animal-based waste products such as urine and feces. Adding compost to the soil enriches the soil with organic matter while green manure increases the nitrogen level of the soil.

You might be interested in

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

How does intestinal failure affect the body? carbon dioxide builds up in the body. carbon dioxide builds up in the body. energy

ratelena [41]

Answer:

Its energy is not given to body

Explanation:

Intestinal failure is basically like where your intestines is slow and has no energy.

5 0

1 year ago

Can someone please answer these for me

Vladimir [108]

Answer:

1. genotype of female: Bb

a. genotype of male: bb

b. white is dominant

c. female phenotype: white

male phenotype: black

5 0

3 years ago

Pls help..............................................................................................

Vesnalui [34]

Answer:

it's the earth's crust

Explanation:

cause it is

5 0

3 years ago

Learning Task 3

lara [203]

The purpose of both mitosis and meiosis is to increase the number or population of cells in the body.

<h3>Compare mitosis and meiosis type of cell division</h3>

Mitosis produces two diploid (2n) cells that are identical to the original parent cell whereas meiosis produces four haploid (n) cells that are different from the original parent cell.

Mitosis occurs in somatic cells whereas meiosis occurs in reproductive cells.

So we can conclude that the purpose of both mitosis and meiosis is to increase the number or population of cells in the body.

Learn more about mitosis here: brainly.com/question/19058180

5 0

2 years ago

Write a difference between compost and green manure​

Write a difference between compost and green manure