Please I need help with biology hw

AURORKA [14]

Answer:

The earth can be said to be a system because each component inside it interacts so that it creates a very large number of collectivities. Components in the earth are incorporated into a Geosphere, namely a layer on the surface or under the surface of the earth that has a direct and indirect influence on the survival of creatures

Explanation:

7 0

3 years ago

Which statement is not true?

creativ13 [48]

<span>All planets revolve around the sun. - Incorrect. There are many planets that revolve around other stars.
</span>

8 0

3 years ago

Which common practice puts the nurse at liability for invasion of patient privacy?

harina [27]

Answer;

-The nurse gives information about the patient to telephone callers who inquire about the patient.

Explanation;

-Medical care requires the invasion of privacy. Patients must expose their innermost thoughts, their bodies, and their sickrooms to strangers. But to protect human dignity, health providers should limit invasions to those necessary to accomplish the goals of their patients.

-Invasion of privacy and confidentiality are of critical legal and medical concern. The right to privacy means that a client has the right to expect that his or her property will be left alone. Healthcare individuals may be charged with trespassing, illegal search and seizure, or releasing private information (even if the information is true).

8 0

2 years ago

A scientist is investigating the effects of electromagnetic radiation on plant growth. She wants to test the plants with two dif

Sladkaya [172]

Answer:

Explanation:c

3 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago