Which of these is NOT a factor contributing to the loss of biodiversity?

Biology

1 answer:

ivann1987 [24]3 years ago

4 0

Answer:

Option C

GOOD LUCK FOR THE FUTURE! :)

You might be interested in

Define and explain conservation.

timurjin [86]

Answer:

conservation is saving and reducing. To help save the earth .. Conservation is the preservation or efficient use of resources,

Explanation:

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Which one of the following is a requirement for a good primer? Select one: a. Guanine and Cytosine should make up less than half

Alex

Answer: B. Melting temperatures of primer should be between 55-80 degree Celsius.

Explanation:

Bacause the melting temperature controls the binding of the primers to your template DNA. At melting temperature 50% of the primer molecules are bound to their corresponding target sequence. If the difference in melting temperature between the two primers is too high, it might be difficult to find experimental conditions where both primers can bind to their target.

3 0

3 years ago

An organism is most closely related to another organism that is in the same_____

Sati [7]

I believe the answer is family

7 0

3 years ago

Sebaceous glands, associated with hair follicles, produce a thick, oily substance by releasing the entire cell and its contents.

lbvjy [14]

Answer:

This type of secretion is known as Holocrine. Whereby the entire cell and content is released

5 0

3 years ago