3 years ago

Give one example of how humans can affect the biosphere. How might that impact the other spheres in the Earth system?

1 answer:

5 0

Answer: Piling up our waste in landfills affects the geosphere. Pumping waste into the oceans harms the hydrosphere. And overfishing and habitat destruction can reduce the diversity of living things in the biosphere.

Explanation: Hope this helps and good luck :)

You might be interested in

Energy from food must be transformed into the bonds of _________ before it can be used by cells.

Leokris [45]

The correct answer to that question is A. ATP

3 0

3 years ago

Read 2 more answers

How is DNA a piece of evidence for evolution

Wittaler [7]

Answer:

DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are. Biogeography. The global distribution of organisms and the unique features of island species reflect evolution and geological change.

Explanation:

5 0

2 years ago

Which branch of earth science learns about the causes of landslides?

Ronch [10]

The natural disasters branch of earthe science. The

5 0

3 years ago

Which enzyme unzips or unwinds the two dna strands away from each other?

alexandr1967 [171]

Answer:

Helicase

Explanation:

5 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago